Leptospirosis is a neglected zoonosis with worldwide distribution. The causative agents are spirochete bacteria of the Leptospira genus, displaying huge diversity of serovars, the identity of which is critical for effective diagnosis and vaccination purposes. Among many other mammalian species, Leptospira infects cattle, eliciting acute signs in calves, and chronic disease in adult animals often leading to abortions. In South America, and including in Uruguay, beef and dairy export are leading sources of national income. Despite the importance of bovine health, food safety, and bovine-related dissemination of leptospirosis to humans, extremely limited information is available as to the identity of Leptospira species and serovars infecting cattle in Uruguay and the South American subcontinent. Here we report a multicentric 3-year study resulting in the isolation and detailed characterization of 40 strains of Leptospira spp. obtained from infected cattle. Combined serologic and molecular typing identified these isolates as L. interrogans serogroup Pomona serovar Kennewicki (20 strains), L. interrogans serogroup Canicola serovar Canicola (1 strain), L. borgpetersenii serogroup Sejroe serovar Hardjo (10 strains) and L. noguchii (9 strains). The latter showed remarkable phenotypic and genetic variability, belonging to 6 distinct serogroups, including 3 that did not react with a large panel of reference serogrouping antisera. Approximately 20% of cattle sampled in the field were found to be shedding pathogenic Leptospira in their urine, uncovering a threat for public health that is being largely neglected. The two L. interrogans serovars that we isolated from cattle displayed identical genetic signatures to those of human isolates that had previously been obtained from leptospirosis patients. This report of local Leptospira strains shall improve diagnostic tools and the understanding of leptospirosis epidemiology in South America. These strains could also be used as new components within bacterin vaccines to protect against the pathogenic Leptospira strains that are actually circulating, a direct measure to reduce the risk of human leptospirosis.

We studied microorganisms associated with infant diarrhea in a group of 256 children admitted to a public pediatric hospital in Montevideo, Uruguay. Diagnostic procedures were updated to optimize detection of potential pathogens, which were found in 63.8% of cases, and to be able to define their characteristics down to molecular or antigenic type. Coinfection with two or more agents was detected in more than one-third of positive studies. Escherichia coli enteric virotypes, especially enteropathogenic E. coli (EPEC), were shown to be prevalent. Rotavirus, Cryptosporidium, Campylobacter (mainly Campylobacter jejuni), and Shigella flexneri were also often identified. Enterotoxigenic E. coli, Salmonella, and Giardia lamblia were sporadically recognized. Unusual findings included two enteroinvasive E. coli strains, one Shigella dysenteriae 2 isolate, and a non-O:1 Vibrio cholerae culture. EPEC bacteria and S. flexneri (but not Salmonella) showed unusually frequent antimicrobial resistance, especially towards beta-lactam antibiotics, which is the subject of ongoing work.

A total of 71 enteropathogenic Escherichia coli (EPEC) strains isolated from children with diarrhoea in Montevideo, Uruguay, were characterized in this study. PCR showed that 57 isolates carried eae and bfp genes (typical EPEC strains), and 14 possessed only the eae gene (atypical EPEC strains). These EPEC strains belonged to 21 O : H serotypes, including eight novel serotypes not previously reported among human EPEC in other studies. However, 72 % belonged to only four serotypes: O55 : H− (six strains), O111 : H2 (13 strains), O111 : H− (14 strains) and O119 : H6 (18 strains). Nine intimin types, namely, α1 (two O142 strains), β1 (29 strains, including 13 O111 : H2 and 14 O111 : H−), γ1 (three O55 : H− strains), θ (five strains, including three strains with H40 antigen), κ (two strains), ε1 (one strain), λ (one strain), μB (six strains of serotypes O55 : H51 and O55 : H−) and ξR/β2B (22 strains, including 18 O119 : H6) were detected among the 71 EPEC strains. The authors have identified two novel intimin genes (μB and ξR/β2B) in typical EPEC strains of serotypes O55 : H51/H− and O119 : H6/H−. The complete nucleotide sequences of the novel μB and ξR/β2 variant genes were determined. PFGE typing after XbaI DNA digestion was performed on 44 representative EPEC strains. Genomic DNA fingerprinting revealed 44 distinct restriction patterns and the strains were clustered in 12 groups. Only 15 strains clustered in six groups of closely related (similarity >85 %) PFGE patterns, suggesting the prevailing clonal diversity among EPEC strains isolated from children with diarrhoea in Montevideo.

BackgroundSalmonella enterica serovar Enteritidis (S. Enteritidis) has caused major epidemics of gastrointestinal infection in many different countries. In this study we investigate genome divergence and pathogenic potential in S. Enteritidis isolated before, during and after an epidemic in Uruguay.Results266 S. Enteritidis isolates were genotyped using RAPD-PCR and a selection were subjected to PFGE analysis. From these, 29 isolates spanning different periods, genetic profiles and sources of isolation were assayed for their ability to infect human epithelial cells and subjected to comparative genomic hybridization using a Salmonella pan-array and the sequenced strain S. Enteritidis PT4 P125109 as reference. Six other isolates from distant countries were included as external comparators.Two hundred and thirty three chromosomal genes as well as the virulence plasmid were found as variable among S. Enteritidis isolates. Ten out of the 16 chromosomal regions that varied between different isolates correspond to phage-like regions. The 2 oldest pre-epidemic isolates lack phage SE20 and harbour other phage encoded genes that are absent in the sequenced strain. Besides variation in prophage, we found variation in genes involved in metabolism and bacterial fitness. Five epidemic strains lack the complete Salmonella virulence plasmid. Significantly, strains with indistinguishable genetic patterns still showed major differences in their ability to infect epithelial cells, indicating that the approach used was insufficient to detect the genetic basis of this differential behaviour.ConclusionThe recent epidemic of S. Enteritidis infection in Uruguay has been driven by the introduction of closely related strains of phage type 4 lineage. Our results confirm previous reports demonstrating a high degree of genetic homogeneity among S. Enteritidis isolates. However, 10 of the regions of variability described here are for the first time reported as being variable in S. Enteritidis. In particular, the oldest pre-epidemic isolates carry phage-associated genetic regions not previously reported in S. Enteritidis. Overall, our results support the view that phages play a crucial role in the generation of genetic diversity in S. Enteritidis and that phage SE20 may be a key marker for the emergence of particular isolates capable of causing epidemics.

Salmonella enterica serovar Enteritidis (S. Enteritidis) is frequently associated with food-borne disease worldwide. Poultry-derived products are a major source. An epidemic of human infection with S. Enteritidis occurred in Uruguay, and to evaluate the extent of poultry contamination, we conducted a nationwide survey over 2 years that included the analysis of sera from 5,751 birds and 12,400 eggs. Serological evidence of infection with Salmonella group O:9 was found in 24.4% of the birds. All positive sera were retested with a gm flagellum-based enzyme-linked immunosorbent assay, and based on these results, the national prevalence of S. Enteritidis infection was estimated to be 6.3%. Salmonellae were recovered from 58 of 620 pools made up of 20 eggs each, demonstrating a prevalence of at least 1 in every 214 eggs. Surprisingly, the majority of the isolates were not S. Enteritidis. Thirty-nine isolates were typed as S. Derby, 9 as S. Gallinarum, 8 as S. Enteritidis, and 2 as S. Panama. Despite the highest prevalence in eggs, S. Derby was not isolated from humans in the period of analysis, suggesting a low capacity to infect humans. Microarray-based comparative genomic hybridization analysis of S. Derby and S. Enteritidis revealed more than 350 genetic differences. S. Derby lacked pathogenicity islands 13 and 14, the fimbrial lpf operon, and other regions encoding metabolic functions. Several of these regions are present not only in serovar Enteritidis but also in all sequenced strains of S. Typhimurium, suggesting that these regions might be related to the capacity of Salmonella to cause food-borne disease.

We report the first Shiga toxin 2-producing Acinetobacter haemolyticus strain that was isolated from the feces of a 3-month-old infant with bloody diarrhea. Usual enteropathogenic bacteria were not detected. This finding suggests that any Shiga toxin-producing microorganism capable of colonizing the human gut may have the potential to cause illness. CASE REPORTIn November 2001, a 3-month-old male infant was admitted at Pereira Rossell Pediatric Hospital with bloody diarrhea of 12 h evolution without fever or other previous pathologies. The patient was treated empirically with intravenous ceftriaxone and hospitalized for 24 h.Samples of feces were obtained before and after the patient was treated with antibiotics, and they were simultaneously studied at the Microbiology laboratory of the Pereira Rossell Pediatric Hospital and at the Reference laboratory for Shiga toxin-producing Escherichia coli. This last study, done in the context of an institutional program aimed at the regional surveillance of bloody diarrheas and hemolytic-uremic syndrome (HUS) etiology, is the focus of the present article.The presence of Salmonella, Shigella, enteroinvasive E. coli, and enteropathogenic E. coli, Yersinia enterocolitica, and Campylobacter in fecal samples was studied using standard procedures, as previously described (18). The searching of Shiga toxin-producing E. coli (STEC) was done by selective enrichment protocol (9) on Trypticase soy broth (Bacto, Le Pont de Claix, France) with 2.5 mg/liter sodium tellurite and 0.05 mg/liter cefixime (CT-TSB; BioMérieux, Marcy LЈÉtoile, France) and further isolation on MacConkey sorbitol (SMAC) plates (Oxoid, Hampshire, England).The microscopic analysis of the two fecal samples showed a low number of leukocytes (5 to 10 per microscopic field) and did not reveal spiral bacteria that would suggest the presence of Campylobacter spp.The cultures from the first fecal sample developed well in all inoculated media.From the second fecal sample, only 12 colonies (all sorbitol negative) were recovered on a directly inoculated SMAC plate after 48 h of culture. From the enrichment broth, we did not recover any microorganism on the SMAC plate.The microbiological studies did not reveal the presence of usual enteropathogenic bacteria in any of the two samples.Twenty sorbitol-positive colonies plus a lysate from the confluent zone in the SMAC plate of the first sample (nonfermenting colonies were not recovered) and the 12 sorbitolnegative colonies recovered from the second sample were analyzed by PCR, as previously described (13), to detect the presence of Stx1/Stx2-encoding organisms. This PCR was performed with primers VT1A-F (GAAGAGTCCGTGGGATT ACG) and VT1B-R (AGCGATGCAGCTATTAATAA) for stx 1 and with primers VT2A-F (TTAACCACACCCACGGCAGT) and VT2B-R (GCTCTGGATGCATCTCTGGT) for stx 2 .E. coli K-12 C600 E. coli K-12 C600 (F Ϫ thi-1 thr-1 leuB6 lacY1 tonA21 supE44 ⌬ ⌬stx 1 ⌬stx 2 ) and Stx2/Stx1-producing E. coli STEC O157:H7 EDL933 were used as negative and positive controls, respectively, in all PCR as...

The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese) were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%), followed by cheese (10%). 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.

We studied 13 extended-spectrum ␤-lactamase (ESBL)-producing enteropathogenic Escherichia coli isolates from children suffering acute diarrhea in Uruguay. ESBL characterization in crude extracts showed a single band at pI 5.4. PCR amplification and sequencing data allowed identification of bla PER-2 and bla TEM-116 . Retrospective analysis suggests that these strains were disseminated in the community, even if unnoticed, prior to their access to the hospital environment more than a decade ago.