We report the first Shiga toxin 2-producing Acinetobacter haemolyticus strain that was isolated from the feces of a 3-month-old infant with bloody diarrhea. Usual enteropathogenic bacteria were not detected. This finding suggests that any Shiga toxin-producing microorganism capable of colonizing the human gut may have the potential to cause illness. CASE REPORTIn November 2001, a 3-month-old male infant was admitted at Pereira Rossell Pediatric Hospital with bloody diarrhea of 12 h evolution without fever or other previous pathologies. The patient was treated empirically with intravenous ceftriaxone and hospitalized for 24 h.Samples of feces were obtained before and after the patient was treated with antibiotics, and they were simultaneously studied at the Microbiology laboratory of the Pereira Rossell Pediatric Hospital and at the Reference laboratory for Shiga toxin-producing Escherichia coli. This last study, done in the context of an institutional program aimed at the regional surveillance of bloody diarrheas and hemolytic-uremic syndrome (HUS) etiology, is the focus of the present article.The presence of Salmonella, Shigella, enteroinvasive E. coli, and enteropathogenic E. coli, Yersinia enterocolitica, and Campylobacter in fecal samples was studied using standard procedures, as previously described (18). The searching of Shiga toxin-producing E. coli (STEC) was done by selective enrichment protocol (9) on Trypticase soy broth (Bacto, Le Pont de Claix, France) with 2.5 mg/liter sodium tellurite and 0.05 mg/liter cefixime (CT-TSB; BioMérieux, Marcy LЈÉtoile, France) and further isolation on MacConkey sorbitol (SMAC) plates (Oxoid, Hampshire, England).The microscopic analysis of the two fecal samples showed a low number of leukocytes (5 to 10 per microscopic field) and did not reveal spiral bacteria that would suggest the presence of Campylobacter spp.The cultures from the first fecal sample developed well in all inoculated media.From the second fecal sample, only 12 colonies (all sorbitol negative) were recovered on a directly inoculated SMAC plate after 48 h of culture. From the enrichment broth, we did not recover any microorganism on the SMAC plate.The microbiological studies did not reveal the presence of usual enteropathogenic bacteria in any of the two samples.Twenty sorbitol-positive colonies plus a lysate from the confluent zone in the SMAC plate of the first sample (nonfermenting colonies were not recovered) and the 12 sorbitolnegative colonies recovered from the second sample were analyzed by PCR, as previously described (13), to detect the presence of Stx1/Stx2-encoding organisms. This PCR was performed with primers VT1A-F (GAAGAGTCCGTGGGATT ACG) and VT1B-R (AGCGATGCAGCTATTAATAA) for stx 1 and with primers VT2A-F (TTAACCACACCCACGGCAGT) and VT2B-R (GCTCTGGATGCATCTCTGGT) for stx 2 .E. coli K-12 C600 E. coli K-12 C600 (F Ϫ thi-1 thr-1 leuB6 lacY1 tonA21 supE44 ⌬ ⌬stx 1 ⌬stx 2 ) and Stx2/Stx1-producing E. coli STEC O157:H7 EDL933 were used as negative and positive controls, respectively, in all PCR as...

ObjectivesShigella sonnei is a globally important diarrhoeal pathogen tracked through the surveillance network PulseNet Latin America and Caribbean (PNLA&C), which participates in PulseNet International. PNLA&C laboratories use common molecular techniques to track pathogens causing foodborne illness. We aimed to demonstrate the possibility and advantages of transitioning to whole genome sequencing (WGS) for surveillance within existing networks across a continent where S. sonnei is endemic.MethodsWe applied WGS to representative archive isolates of S. sonnei (n = 323) from laboratories in nine PNLA&C countries to generate a regional phylogenomic reference for S. sonnei and put this in the global context. We used this reference to contextualise 16 S. sonnei from three Argentinian outbreaks, using locally generated sequence data. Assembled genome sequences were used to predict antimicrobial resistance (AMR) phenotypes and identify AMR determinants.ResultsS. sonnei isolates clustered in five Latin American sublineages in the global phylogeny, with many (46%, 149 of 323) belonging to previously undescribed sublineages. Predicted multidrug resistance was common (77%, 249 of 323), and clinically relevant differences in AMR were found among sublineages. The regional overview showed that Argentinian outbreak isolates belonged to distinct sublineages and had different epidemiologic origins.ConclusionsLatin America contains novel genetic diversity of S. sonnei that is relevant on a global scale and commonly exhibits multidrug resistance. Retrospective passive surveillance with WGS has utility for informing treatment, identifying regionally epidemic sublineages and providing a framework for interpretation of prospective, locally sequenced outbreaks.

eThe nontyphoidal Salmonella enterica serovar Dublin is adapted to cattle but infrequently infects humans, very often resulting in invasive infections with high levels of morbidity and mortality. A Salmonella-induced intestinal acute inflammatory response is postulated as a mechanism to prevent bacterial dissemination to systemic sites. In S. enterica serovar Typhimurium, flagella contribute to this response by providing motility and FliC-mediated activation of pattern recognition receptors. In this study, we found 4 Salmonella enterica isolates, with the antigenic formula 9,12:؊:؊, that, based on fliC sequence and multilocus sequence type (MLST) analyses, are aflagellate S. Dublin isolates. Interestingly, all were obtained from human bloodstream infections. Thus, we investigated the potential role of flagella in the unusual invasiveness exhibited by S. Dublin in humans by analyzing flagellation and proinflammatory properties of a collection of 10 S. Dublin human clinical isolates. We found that 4 of 7 blood isolates were aflagellate due to significantly reduced levels of fliC expression, whereas all 3 isolates from other sources were flagellated. Lack of flagella correlated with a reduced ability of triggering interleukin-8 (IL-8) and CCL20 chemokine expression in human intestinal Caco-2 cells and with reduced early inflammation in the ceca of streptomycin-pretreated C57/BL6 mice. These results indicate that flagella contribute to the host intestinal inflammatory response to Salmonella serovar Dublin and suggest that their absence may contribute to its systemic dissemination through dampening of the gut immune response. Analysis of FliC production in a collection of cattle isolates indicated that the aflagellate phenotype is widely distributed in field isolates of S. Dublin.

We studied 13 extended-spectrum ␤-lactamase (ESBL)-producing enteropathogenic Escherichia coli isolates from children suffering acute diarrhea in Uruguay. ESBL characterization in crude extracts showed a single band at pI 5.4. PCR amplification and sequencing data allowed identification of bla PER-2 and bla TEM-116 . Retrospective analysis suggests that these strains were disseminated in the community, even if unnoticed, prior to their access to the hospital environment more than a decade ago.

No abstract