Shiga Toxin 2-Producing Acinetobacter haemolyticus Associated with a Case of Bloody Diarrhea

Abstract

We report the first Shiga toxin 2-producing Acinetobacter haemolyticus strain that was isolated from the feces of a 3-month-old infant with bloody diarrhea. Usual enteropathogenic bacteria were not detected. This finding suggests that any Shiga toxin-producing microorganism capable of colonizing the human gut may have the potential to cause illness. CASE REPORTIn November 2001, a 3-month-old male infant was admitted at Pereira Rossell Pediatric Hospital with bloody diarrhea of 12 h evolution without fever or other previous pathologies. The patient was treated empirically with intravenous ceftriaxone and hospitalized for 24 h.Samples of feces were obtained before and after the patient was treated with antibiotics, and they were simultaneously studied at the Microbiology laboratory of the Pereira Rossell Pediatric Hospital and at the Reference laboratory for Shiga toxin-producing Escherichia coli. This last study, done in the context of an institutional program aimed at the regional surveillance of bloody diarrheas and hemolytic-uremic syndrome (HUS) etiology, is the focus of the present article.The presence of Salmonella, Shigella, enteroinvasive E. coli, and enteropathogenic E. coli, Yersinia enterocolitica, and Campylobacter in fecal samples was studied using standard procedures, as previously described (18). The searching of Shiga toxin-producing E. coli (STEC) was done by selective enrichment protocol (9) on Trypticase soy broth (Bacto, Le Pont de Claix, France) with 2.5 mg/liter sodium tellurite and 0.05 mg/liter cefixime (CT-TSB; BioMérieux, Marcy LЈÉtoile, France) and further isolation on MacConkey sorbitol (SMAC) plates (Oxoid, Hampshire, England).The microscopic analysis of the two fecal samples showed a low number of leukocytes (5 to 10 per microscopic field) and did not reveal spiral bacteria that would suggest the presence of Campylobacter spp.The cultures from the first fecal sample developed well in all inoculated media.From the second fecal sample, only 12 colonies (all sorbitol negative) were recovered on a directly inoculated SMAC plate after 48 h of culture. From the enrichment broth, we did not recover any microorganism on the SMAC plate.The microbiological studies did not reveal the presence of usual enteropathogenic bacteria in any of the two samples.Twenty sorbitol-positive colonies plus a lysate from the confluent zone in the SMAC plate of the first sample (nonfermenting colonies were not recovered) and the 12 sorbitolnegative colonies recovered from the second sample were analyzed by PCR, as previously described (13), to detect the presence of Stx1/Stx2-encoding organisms. This PCR was performed with primers VT1A-F (GAAGAGTCCGTGGGATT ACG) and VT1B-R (AGCGATGCAGCTATTAATAA) for stx 1 and with primers VT2A-F (TTAACCACACCCACGGCAGT) and VT2B-R (GCTCTGGATGCATCTCTGGT) for stx 2 .E. coli K-12 C600 E. coli K-12 C600 (F Ϫ thi-1 thr-1 leuB6 lacY1 tonA21 supE44 ⌬ ⌬stx 1 ⌬stx 2 ) and Stx2/Stx1-producing E. coli STEC O157:H7 EDL933 were used as negative and positive controls, respectively, in all PCR as...

The Ecology, Biology and Pathogenesis of Acinetobacter spp.: An Overview

“…They are the second most commonly isolated nonfermenters in human specimens (81), after Pseudomonas aeruginosa and their incidence is on the increase and mortality rates are quite high (56,111,119). A. baumannii was found to be associated with a series of fatal cases of community pneumonia (29) and A. haemolyticus, with endocarditis and verotoxin production, and hence bloody diarrhea (11,17,47). Pathogenic mechanisms.…”

“…Previously ampicillin, second generation cephalosporins, quinolones, minocyline, colistin, amynoglycosides, impenim, sulbactam and gentamicin were used to treat Acinetobacter infections. Resistance to these antibiotics has hindered therapeutic management, causing growing concern the world over (32,47,87,91,115). A. baumannii has been developing resistance to all antibiotics used in treating infections.…”

“…iii) Verotoxins: Grotiuz et al (47) first reported the production of verotoxins in Acinetobacter (from A. haemolyticus). Verotoxins are associated with bloody diarrheas and produced by many enteric bacteria including E. coli and Shigella dysenteriae (31).…”

“…to the species level. Thus several molecular diagnostic methods including the polymerase chain reaction (PCR) (47), PFGE, RAPD-PCR DNA fingerprinting (16,86), fluorescent in situ hybridization (FISH) (112), 16S rRNA gene restriction analysis (ARDRA) (79), and 16S rRNA gene PCR-DGGE fingerprinting for genetic characterization of Acinetobacter spp. from environmental samples Vanbroekhoven et al have been employed (112).…”

Isolation and Identification of an Enterobacter cloacae Strain Producing a Novel Subtype of Shiga Toxin Type 1

“…However, other Stx-producing microorganisms have been infrequently reported and include Acinetobacter haemolyticus, Aeromonas sp., Citrobacter freundii, Enterobacter cloacae, and Escherichia albertii (12)(13)(14)(15)(16). The Shiga toxins expressed by these microorganisms have been found to be highly similar in amino acid sequences to those produced by E. coli strains.…”