Sod-based production systems have been successful in the southeastern and mid-Atlantic regions of the United States as an alternative to conventional tillage systems. However, research comparing these systems in North Carolina is limited. Th erefore, research was conducted at four locations in North Carolina to compare corn (Zea mays L.), cotton (Gossypium hirsutum L.), peanut (Arachis hypogaea L.), and soybean [Glycine max (L.) Merr.] yield when these crops were strip tilled following 4 yr of continuous tall fescue (Shedonorus phoenix Scop.) vs. 4 yr of either corn or cotton grown in no tillage or strip tillage. Cotton yield was higher following tall fescue compared with yield following agronomic crops. In contrast, yield of corn was lower following tall fescue compared with agronomic crops while peanut and soybean yields were not aff ected by previous cropping history. Additional treatments in peanut included conventional tillage following both cropping systems, and pod yield was lower when peanut was strip tilled into either tall fescue or residue from corn or cotton compared with conventional tillage systems. No major diff erences in soil bulk density at depths of 0 to 8 cm or 8 to 16 cm were noted when comparing tall fescue or agronomic crops either in strip tillage or nontilled zones. Populations of soil parasitic nematodes were oft en lower in peanut following tall fescue than when following agronomic crops. Th ese experiments indicate that sod-based systems may be an eff ective alternative to reduced tillage systems, especially for cotton. However, yield benefi ts were not observed for peanut or soybean and corn was negatively aff ected by tall fescue.Abbreviations: CBR, Cylindrocladium black rot; %ELK, percentage of extra large kernels; %FP, percentage of fancy pods; %OK, percentage of other kernels; %SMK, percentage of sound mature kernels; %SS, percentage of sound splits; %TSMK, percentage of total sound mature kernels; TSW, tomato spotted wilt.

No abstract

A new species of Paurodontoides, P. siddiqii n. sp., is described and illustrated based on its morphological, morphometric, and molecular characters. The new species is characterized by a female 550–729 μm long, lip region continuous with body contour, stylet length 7.0–8.0 μm long or c. 1.0–1.2 times the lip region diameter, lateral fields with four smooth incisures, excretory pore at 85–125 μm from anterior end located at the base of the pharyngeal bulb or posterior to it, basal pharyngeal bulb with a short posterior extension projecting into the intestine, monodelphic–prodelphic reproductive system with prominent 19–22 μm long post-uterine sac, and elongate conoid tail with a filiform terminus. The new species is compared with two known species of the genus. It differs from the type species of the genus, P. linfordi, by having slightly shorter stylet, lateral field with smooth incisures, different position of the excretory pore, and absence of male. Compared to P. latus, the new species has a shorter body, shorter stylet, different position of the excretory pore, female tail shape and absence of male. The new species was also compared with close species of the genus Paurodontus because of lateral field marked with four lines, asymmetrical stylet knobs and absence of male. Molecular phylogenetic studies of the new species using partial sequences of 18S rDNA revealed that it forms a clade with a species of the genus Ficotylus. In phylogenetic analyses using partial sequences of the 28S rDNA D2-D3 domain, the new species formed a monophyletic group with a species of the genus Veleshkinema and Sphaerularia spp. (Sphaerulariinae).

Summary During a nematode biodiversity survey from 2012 to 2014 in Shenzhen, China, ten nematode populations (SZX1301–SZX1310) of Xiphinema were recovered from rhizosphere of different plants, namely Acacia mangium (SZX1306), A. confuse (SZX1309), Blechnum orientale (SZX1301, SZX1302, SZX1307, SZX1308), Litchi chinensis (SZX1304, SZX1310) in Tianxinshan and Gleichenia linearis (SZX1303, SZX1305) in Yangmeikeng environmental monitoring sites. Morphological and molecular profiles of these populations were determined. Three species of Xiphinema, i.e., X. hunaniense Wang & Wu, 1992, X. brasiliense Lordello, 1951 and X. americanum Cobb, 1913 sensu lato were identified using morphological characters and molecular data of partial 18S and 28S D2–D3 rDNA expansion segments. Four populations (SZX1301–SZX1304) were X. hunaniense, one population (SZX1305) X. brasiliense, and five populations (SZX1306–SZX1310) X. americanum s.l.. Phylogenetic analysis based on sequences of the 28S rDNA D2–D3 expansion segment revealed these three species are all distinct species and supported a close relationship with their corresponding species. This is the first report of X. hunaniense, X. brasiliense and X. americanum s.l. in their hosts except for L. chinensis.

Research was conducted in North Carolina from 2001 to 2006 to determine disease development, parasitic nematode population in soil, crop yield, and cumulative economic return in rotation systems including corn, peanut, and tobacco. Specific rotations included two consecutive cycles of corn‐corn‐peanut, corn‐tobacco‐peanut, or tobacco‐corn‐peanut; five years of corn followed by peanut, and corn‐corn‐tobacco‐corn‐corn‐peanut. In the final year of the experiment when only peanut was planted, the Cylindrocladium black rot (caused by Cylindrocladium parasiticum) (CBR)‐susceptible cultivar Gregory and the CBR‐resistant cultivar Perry were included. Increasing the number of years between peanut plantings increased yield of peanut in the final year of the experiment when Gregory was planted but not when Perry was planted. Incidence of CBR was highest when peanut was planted twice during the duration of the experiment compared with only once. No difference in ring nematode was observed regardless of rotation in the final year of the experiment. The highest soil population of stunt nematode was noted when five years of corn was followed by peanut with the lowest soil population of this nematode noted following two cycles of tobacco‐corn‐peanut. Cropping systems that included tobacco provided higher cumulative economic returns regardless of rotation sequence in most instances.

Paractinolaimus sahandi n. sp., found in wet soil samples collected from the rhizosphere of grasses of Sahand Mountains, Iran, is described. This new species is characterized by its long body (3.5-4.7 mm), high a value (74.5-88.5), anterior location of posterior subventral nuclei, occupying 62.5-68.0% of glandularium distance, the presence of 1-4 pre- and 1-3 post-vulval papillae and numerous tiny, not innervated papillae in front and behind the vulva in the outer layer of cuticle; common functional males in the population, with 62.5-81.3 μm long spicules and 15-17 ventromedian supplements. The new species, which is the only one in the genus showing the advulval cuticular tiny papillae and is unusually slender, is compared to four species of Paractinolaimus, namely P. macrolaimus, P. longidrilus, P. spanithelus and P. rafiqi. The ribosomal 18S rDNA (1246 bp sequenced) and 28S rDNA D2/D3 region (844 bp sequenced) of P. sahandi n. sp. were sequenced for molecular characterization. Sequences of the 18S and 28S D2/D3 of P. sahandi n. sp. have distinct differences from those of the only sequenced P. macrolaimus, with 6 bp differences in 18S and 38 bp differences and five gaps in 28S. This is the first report of the occurrence of members of Actinolaimidae in Iran.

In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.

323 SummaryStudies were conducted to characterize morphological and molecular profiles of two isolates of Paratrichodorus porosus (SZ1 and SZ2) which were recovered from Acacia mangium in Tianxinshan and Gleichenia linearis in Yangmeikeng environmental monitoring sites in Shenzhen, China, respectively. Analysis of morphometric, morphological and molecular characters revealed these two Shenzhen isolates are identical to P. porosus. Measurements of both study isolates lie within the ranges for P. porosus. It is typologically characterized by possessing a clearly swollen body cuticle after fixation, an onchiostyle ventrally curved, 46 -58 μm long, a pharyngeal bulb usually with a well developed anterior-dorsal intestinal overlap, a secretoryexcretory pore opening between the nerve ring and anterior end of pharyngeal bulb, 90 -110 μm from the anterior end, a reproductive system with didelphic, amphidelphic, without spermathecae, a pore-like vulva in ventral view and occupying 52.0 % -59.5 % of total body length from anterior end, a short and barrel-shaped vagina with small sclerotizations, a pair of ventromedian advulvar body pores located prevulvar and postvulvar, a rounded tail and a subterminal anus in females. The sequence analysis based on partial rDNA 18S gene and 28S D2/D3 expansion segment confirm its identity as P. porosus. This is the first report of P. porosus associated with A. mangium and G. linearis.