Highly pathogenic avian influenza (HPAI) A(H5N1) viruses have been circulating since 2003 in Indonesia, with major impacts on poultry health, severe economic losses, and 168 fatal laboratory-confirmed human cases. We performed phylogenetic analysis on 39 full-genome H5N1 virus samples collected during outbreaks among poultry in 2015–2016 in West Java and compared them with recently published sequences from Indonesia. Phylogenetic analysis revealed that the hemagglutinin gene of all samples belonged to 2 genetic groups in clade 2.3.2.1c. We also observed these groups for the neuraminidase, nucleoprotein, polymerase, and polymerase basic 1 genes. Matrix, nonstructural protein, and polymerase basic 2 genes of some HPAI were most closely related to clade 2.1.3 instead of clade 2.3.2.1c, and a polymerase basic 2 gene was most closely related to Eurasian low pathogenicity avian influenza. Our results detected a total of 13 reassortment types among HPAI in Indonesia, mostly in backyard chickens in Indramayu.

Although vaccination of poultry for control of highly pathogenic avian influenza virus (HPAIV) H5N1 has been practiced during the last decade in several countries, its effectiveness under field conditions remains largely unquantified. Effective HPAI vaccination is however essential in preventing incursions, silent infections and generation of new H5N1 antigenic variants. The objective of this study was to asses the level and duration of vaccine induced immunity in commercial layers in Indonesia. Titres of H5N1 haemagglutination inhibition (HI) antibodies were followed in individual birds from sixteen flocks, age 18–68 week old (wo). The study revealed that H5N1 vaccination had highly variable outcome, including vaccination failures, and was largely ineffective in providing long lasting protective immunity. Flocks were vaccinated with seven different vaccines, administer at various times that could be grouped into three regimes: In regime A, flocks (n = 8) were vaccinated two or three times before 19 wo; in regime B (n = 2), two times before and once after 19 wo; and in regime C (n = 6) three to four times before and two to three times after 19 wo. HI titres in regime C birds were significantly higher during the entire observation period in comparison to titres of regime A or B birds, which also differed significantly from each other. The HI titres of individual birds in each flock differed significantly from birds in other flocks, indicating that the effectiveness of field vaccination was highly variable and farm related. Protective HI titres of >4log2, were present in the majority of flocks at 18 wo, declined thereafter at variable rate and only two regime C flocks had protective HI titres at 68 wo. Laboratory challenge with HPAIV H5N1 of birds from regime A and C flocks confirmed that protective immunity differed significantly between flocks vaccinated by these two regimes. The study revealed that effectiveness of the currently applied H5N1 vaccination could be improved and measures to achieve this are discussed.

Background and Aim: Existing data on the characteristics of infectious bronchitis virus (IBV) gathered throughout Indonesia have been recognized to indicate variants similar to globally distributed vaccine strains. Despite past and current intensive vaccination programs, IBV infections in the country's poultry industry have not been effectively controlled. Therefore, this study aimed to investigate the genotype of several isolates based on partial S1 gene sequences. In particular, the investigation is directed to focus on layer chickens in actively vaccinated farms indicating IBV symptoms. Materials and Methods: Samples were isolated from ten different layer chicken flocks experiencing respiratory problem, drops in egg production, and a "penguin-like" stance, which were collected from commercial poultry farms in Central Java and Yogyakarta regions, Indonesia, within the periods of 2012-2018. Fragment of the S1 gene of IBV sampled from actively vaccinated commercial poultry farms was amplified using primer 5'-aca tgg taa ttt ttc aga tgg-3' (forward) and 5'-cag att gct tac aac cac c-3' (reverse) with the length of polymerase chain reaction (PCR) product at 383 bp. The sequence of samples was then compared with the sequence of reference S1 gene nucleotides of IBV from NCBI GenBank database. The amino acid analysis and multiple alignment sequence were conducted using Mega X. Results: During necropsy, enlargement of the oviduct and swollen kidney were observed. Reverse transcription-PCR diagnosis of their 383 bp S1 gene showed that all samples were IBV positive. Phylogenetic analysis of the S1 gene discovered seven samples to be clustered as 4/91-like strains. Meanwhile, the remaining three samples were grouped in QX-like strain cluster. Conclusion: This study is a pioneering report providing molecular evidence of pathogenic QX-like and 4/91-like strains circulating in Indonesia. Findings discovered, in this study, strongly suggested the importance of improving protections by available IBV vaccines through updated circulating strain clusters. It is critical to ensure the delivery of an effective control measurement of and vaccination protocols against IBV infections in the country's commercial poultry industry in particular and worldwide in general.

No abstract

No abstract

To help guide surveillance and control of highly pathogenic avian influenza subtype H5N1 (H5N1-HPAI), the Food and Agriculture Organization of the United Nations in 2004 devised a poultry farm classification system based on a combination of production and biosecurity practices. Four "Sectors" were defined, and this scheme has been widely adopted within Indonesia to guide national surveillance and control strategies. Nevertheless, little detailed research into the robustness of this classification system has been conducted, particularly as it relates to independent, small to medium-sized commercial poultry farms (Sector 3). Through an analysis of questionnaire data collected as part of a survey of layer farms in western and central Java, all of which were classified as Sector 3 by local veterinarians, we provide benchmark data on what defines this sector. A multivariate analysis of the dataset, using hierarchical cluster analysis, identified three groupings of the farms, which were defined by a combination of production-and biosecurity-related variables, particularly those related to farm size and (the lack of) washing and disinfection practices. Nevertheless, the relationship between production-related variables and positive biosecurity practices was poor, and larger farms did not have an overall higher total biosecurity score than small or medium-sized ones. Further research is required to define the properties of poultry farms in Indonesia that are most closely related to effective biosecurity and the prevention of H5N1-HPAI.

The experiment was conducted to evaluate the influence of feed additive containing lactic acid bacteria (LAB) and Ganoderma lucidum (GL) on body weight gain (BWG), feed efficiency (FE), performance index (PI), antibody titer (AT) against Newcastle disease and histopathology of broilers. Bacteria used were Lactobacillus salivarius and Pediococcus pentosaceus, which were isolated from broiler's intestine. A number of 195 unsexed day old chicks (Cobb strain) were arranged in a completely randomized design and consisted of 5 treatments, each in 3 equal replicates. The treatments were as followed T0: control/without-feed additive, T1: 1% LAB (10 9 cfu g-1), T2: 1% GL, T3: 1% of LAB 10 9 cfu g-1 + GL (1:1), T4: commercial antibiotic. Data were analyzed using ANOVA and continued to Duncan's multiple range test. The results showed that T2, T3, T4 treatments significantly improved (P<0.05) BWG, FE and PI of broilers. Broilers fed T3 had the highest PI, followed by T4, T1, T2 and T0. Broilers fed T3 had the highest AT value followed by T0, T2, T4, and T1. Histopathology profile showed that broiler fed T3 had no lesion on liver and intestine compared to others. The result of this experiment indicated that additive containing 0.25% L. salivarius, 0.25% P. pentosaceus, and 0.5% G. lucidum was able to enhance broiler performance.

Background and Aim:Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and Methods:The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5’ GTGAGTGCAACCCCTTTAGGTTGT 3’ and reverse 3’ TAGACCCCAGTGATGCATGAGTTG 3’ with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.Result:The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.Conclusion:Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.