Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Abstract

Background and Aim:Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.Materials and Methods:The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5’ GTGAGTGCAACCCCTTTAGGTTGT 3’ and reverse 3’ TAGACCCCAGTGATGCATGAGTTG 3’ with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.Result:The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.Conclusion:Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Genetic characterization and distribution of the virus in chicken embryo tissues infected with Newcastle disease virus isolated from commercial and native chickens in Indonesia

“…NDV with the E347K variation in HN protein in the cross-neutralization assay showed a lower antigenic association with LaSota [41]. In this study, none of the isolates had mutations in the E347K amino acid residue, as previously reported in Indonesia [42].…”

Deteksi Virus Newcastle Disease pada Burung Merpati (Columba Livia) dan Burung Tekukur (Streptopilia Chinensis) yang Menunjukkan Gejala Syaraf

“…Hospes utama penyakit ND adalah ayam ras, ayam bukan ras dan beberapa spesies unggas dan burung. Beberapa kasus ND pada ayam ras komersial baik layer dan broiler telah dilaporkan oleh Wibowo et al, (2012), Wibowo et al, (2017); Triosanti et al, (2018); Putri et al, (2017). Kasus ND pada ayam buras dilaporkan oleh Adi et al, (2009), sedangkan kasus ND pada merpati dilaporkan oleh Dewandaru et al (2020).…”

“…(Alexander, 2003;Daud et al, 2019;Wibowo et al, 2017;Shanmuganathan et al, 2017). Namun demikian beberapa peneliti juga mempunyai preferensi untuk mendeteksi gen HN (Triosanti et al, 2018, Wulandari et al, 2021, Soltani et al, 2019, serta gen lain seperti gen matriks juga dapat menjadi target deteksi pada virus ND (Daud et al, 2019) Hasil sekuensing berupa data ABI file dan urutan disejajarkan menggunakan software MEGA_X. Sekuens yang diperoleh dengan panjang 700 nukleotida yaitu pada posisi 112-812 atau asam amino ke 42-270 pada gen F. Susunan asam amino pada cleavage site virus yang bersifat patogenik adalah 112 R/K-R-Q/K/R-K/R-R-F 117 dan Fenilalanin (F) pada urutan asam amino ke 117 (Choi et al, 2012).…”

Review detection of Newcastle disease virus

“…In 1926, ND was first reported to Indonesia ( 5 , 6 ). In 1927, Doyle isolated the virus in Newcastle, England, and named it NDV ( 7 ). Then numerous outbreaks of different avian species associated with virulent NDV were reported in North America (United States of America, Canada, and Costa Rica), Europe (France, Italy, England, Scotland, Spain, and Russia), Africa (Kenya), Asia (China, Korea, India, Japan, Sri Lanka, Saudi Kazakhstan, Philippines, and Arabia) and Australia ( 8 , 9 ).…”