SUMMARYMutations that disrupt function of the human inwardly rectifying potassium channel KIR2.1 are associated with the craniofacial and digital defects of Andersen-Tawil Syndrome, but the contribution of Kir channels to development is undefined. Deletion of mouse Kir2.1 also causes cleft palate and digital defects. These defects are strikingly similar to phenotypes that result from disrupted TGF/BMP signaling. We use Drosophila melanogaster to show that a Kir2.1 homolog, Irk2, affects development by disrupting BMP signaling. Phenotypes of irk2 deficient lines, a mutant irk2 allele, irk2 siRNA and expression of a dominant-negative Irk2 subunit (Irk2DN) all demonstrate that Irk2 function is necessary for development of the adult wing. Compromised Irk2 function causes wingpatterning defects similar to those found when signaling through a Drosophila BMP homolog, Decapentaplegic (Dpp), is disrupted. To determine whether Irk2 plays a role in the Dpp pathway, we generated flies in which both Irk2 and Dpp functions are reduced. Irk2DN phenotypes are enhanced by decreased Dpp signaling. In wild-type flies, Dpp signaling can be detected in stripes along the anterior/posterior boundary of the larval imaginal wing disc. Reducing function of Irk2 with siRNA, an irk2 deletion, or expression of Irk2DN reduces the Dpp signal in the wing disc. As Irk channels contribute to Dpp signaling in flies, a similar role for Kir2.1 in BMP signaling may explain the morphological defects of Andersen-Tawil Syndrome and the Kir2.1 knockout mouse. DEVELOPMENT MATERIALS AND METHODS Maintenance of Drosophila stocksStocks were maintained on cornmeal food at 25°C or 18°C in a Percival incubator model 122 vL (Percival Scientific). Generation of the UAS-Irk2DN and UAS-Irk2WT fly strainsirk2A from Berlin w1118 fly cDNA was cloned into the EcoRI and XhoI sites of the pUAST vector. PCR was performed with cDNA template and primers (GGAATTCCATGCGTTTCAATTTCTCC and CCGCTCGAGCGGCTA -GGA GGCCTGGTCAGA) to add EcoRI and XhoI sites. Sequencing ensured fidelity of the construct. UAS-Irk2 DN was constructed by cutting irk2A out of UAS-irk2 WT with EcoRI and XhoI, and ligating into pET. The GYG of pET-Irk2A template plasmid was mutated to AAA using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) with the following primers: ACGCAGCACACTATTGCCGCTGCCGTCC-GAACCACCTCG and CGAGGTGGTTCGGACGGCAGCGGCAATA -GTGTGCTGCGT. Irk2-DN was removed from the pET vector with EcoRI and XhoI restriction enzymes and ligated into pUAST. All constructs were sequenced to verify the GYG to AAA mutations. We injected UAS-Irk2 WT or UAS-Irk2 DN plasmid with transposase DNA into 1-hour-old Berlin w1118 embryos. Matured injected flies were crossed to Berlin w1118 and progeny with the transgene were selected by eye color. irk1-AAA and irk3-AAA were generated with the same strategy using primer pairs: ACCCAGACGAC-GATAGCCGCTGCCAATC/CGTCACATAGCGATTGGCAGCGGCTA T -C (Irk1-AAA) and ATCGAGTCCAAGATACGAGTCTACATCATC/GAT-GATGTAGACTCGTATCTTGGACTCGATGGA (Irk3-AAA). Drosophila strainsT...

β-Thalassemia is one of the most common genetic blood diseases and is caused by either point mutations or deletions in the β-globin (HBB) gene. The generation of patient-specific induced pluripotent stem cells (iPSCs) and subsequent correction of the disease-causing mutations may be a potential therapeutic strategy for this disease. Due to the low efficiency of typical homologous recombination, endonucleases, including TALENs and CRISPR/Cas9, have been widely used to enhance the gene correction efficiency in patient-derived iPSCs. Here, we designed TALENs and CRISPR/Cas9 to directly target the intron2 mutation site IVS2-654 in the globin gene. We observed different frequencies of double-strand breaks (DSBs) at IVS2-654 loci using TALENs and CRISPR/Cas9, and TALENs mediated a higher homologous gene targeting efficiency compared to CRISPR/Cas9 when combined with the piggyBac transposon donor. In addition, more obvious off-target events were observed for CRISPR/Cas9 compared to TALENs. Finally, TALENs-corrected iPSC clones were selected for erythroblast differentiation using the OP9 co-culture system and detected relatively higher transcription of HBB than the uncorrected cells. This comparison of using TALENs or CRISPR/Cas9 to correct specific HBB mutations in patient-derived iPSCs will guide future applications of TALENs- or CRISPR/Cas9-based gene therapies in monogenic diseases.

No abstract

No abstract