HIV-1 capsid core disassembly (uncoating) must occur before integration of viral genomic DNA into the host chromosomes, yet remarkably, the timing and cellular location of uncoating is unknown. Previous studies have proposed that intact viral cores are too large to fit through nuclear pores and uncoating occurs in the cytoplasm in coordination with reverse transcription or at the nuclear envelope during nuclear import. The capsid protein (CA) content of the infectious viral cores is not well defined because methods for directly labeling and quantifying the CA in viral cores have been unavailable. In addition, it has been difficult to identify the infectious virions because only one of ∼50 virions in infected cells leads to productive infection. Here, we developed methods to analyze HIV-1 uncoating by direct labeling of CA with GFP and to identify infectious virions by tracking viral cores in living infected cells through viral DNA integration and proviral DNA transcription. Astonishingly, our results show that intact (or nearly intact) viral cores enter the nucleus through a mechanism involving interactions with host protein cleavage and polyadenylation specificity factor 6 (CPSF6), complete reverse transcription in the nucleus before uncoating, and uncoat <1.5 h before integration near (<1.5 μm) their genomic integration sites. These results fundamentally change our current understanding of HIV-1 postentry replication events including mechanisms of nuclear import, uncoating, reverse transcription, integration, and evasion of innate immunity.

Transforming growth factor-betas (TGF-beta) comprise a superfamily of secreted proteins with diverse functions in patterning and cell division control. TGF-beta signaling has been implicated in synapse assembly and plasticity in both vertebrate and invertebrate systems. Recently, wishful thinking, a Drosophila gene that encodes a protein related to BMP type II receptors, has been shown to be required for the normal function and development of the neuromuscular junction (NMJ). These findings suggest that a TGF-beta-related ligand activates a signaling cascade involving type I and II receptors and the Smad family of transcription factors to orchestrate the assembly of the NMJ. Here we demonstrate that the TGF-beta type I receptor Saxophone and the downstream transcription factor Mothers against dpp (Mad) are essential for the normal structural and functional development of the Drosophila NMJ, a synapse that displays activity-dependent plasticity.

SUMMARYMutations that disrupt function of the human inwardly rectifying potassium channel KIR2.1 are associated with the craniofacial and digital defects of Andersen-Tawil Syndrome, but the contribution of Kir channels to development is undefined. Deletion of mouse Kir2.1 also causes cleft palate and digital defects. These defects are strikingly similar to phenotypes that result from disrupted TGF/BMP signaling. We use Drosophila melanogaster to show that a Kir2.1 homolog, Irk2, affects development by disrupting BMP signaling. Phenotypes of irk2 deficient lines, a mutant irk2 allele, irk2 siRNA and expression of a dominant-negative Irk2 subunit (Irk2DN) all demonstrate that Irk2 function is necessary for development of the adult wing. Compromised Irk2 function causes wingpatterning defects similar to those found when signaling through a Drosophila BMP homolog, Decapentaplegic (Dpp), is disrupted. To determine whether Irk2 plays a role in the Dpp pathway, we generated flies in which both Irk2 and Dpp functions are reduced. Irk2DN phenotypes are enhanced by decreased Dpp signaling. In wild-type flies, Dpp signaling can be detected in stripes along the anterior/posterior boundary of the larval imaginal wing disc. Reducing function of Irk2 with siRNA, an irk2 deletion, or expression of Irk2DN reduces the Dpp signal in the wing disc. As Irk channels contribute to Dpp signaling in flies, a similar role for Kir2.1 in BMP signaling may explain the morphological defects of Andersen-Tawil Syndrome and the Kir2.1 knockout mouse. DEVELOPMENT MATERIALS AND METHODS Maintenance of Drosophila stocksStocks were maintained on cornmeal food at 25°C or 18°C in a Percival incubator model 122 vL (Percival Scientific). Generation of the UAS-Irk2DN and UAS-Irk2WT fly strainsirk2A from Berlin w1118 fly cDNA was cloned into the EcoRI and XhoI sites of the pUAST vector. PCR was performed with cDNA template and primers (GGAATTCCATGCGTTTCAATTTCTCC and CCGCTCGAGCGGCTA -GGA GGCCTGGTCAGA) to add EcoRI and XhoI sites. Sequencing ensured fidelity of the construct. UAS-Irk2 DN was constructed by cutting irk2A out of UAS-irk2 WT with EcoRI and XhoI, and ligating into pET. The GYG of pET-Irk2A template plasmid was mutated to AAA using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) with the following primers: ACGCAGCACACTATTGCCGCTGCCGTCC-GAACCACCTCG and CGAGGTGGTTCGGACGGCAGCGGCAATA -GTGTGCTGCGT. Irk2-DN was removed from the pET vector with EcoRI and XhoI restriction enzymes and ligated into pUAST. All constructs were sequenced to verify the GYG to AAA mutations. We injected UAS-Irk2 WT or UAS-Irk2 DN plasmid with transposase DNA into 1-hour-old Berlin w1118 embryos. Matured injected flies were crossed to Berlin w1118 and progeny with the transgene were selected by eye color. irk1-AAA and irk3-AAA were generated with the same strategy using primer pairs: ACCCAGACGAC-GATAGCCGCTGCCAATC/CGTCACATAGCGATTGGCAGCGGCTA T -C (Irk1-AAA) and ATCGAGTCCAAGATACGAGTCTACATCATC/GAT-GATGTAGACTCGTATCTTGGACTCGATGGA (Irk3-AAA). Drosophila strainsT...

Heparan sulfate proteoglycans (HSPGs), a class of glycosaminoglycan-modified proteins, control diverse patterning events via their regulation of growth-factor signaling and morphogen distribution. In C. elegans, zebrafish, and the mouse, heparan sulfate (HS) biosynthesis is required for normal axon guidance, and mutations affecting Syndecan (Sdc), a transmembrane HSPG, disrupt axon guidance in Drosophila embryos. Glypicans, a family of glycosylphosphatidylinositol (GPI)-linked HSPGs, are expressed on axons and growth cones in vertebrates, but their role in axon guidance has not been determined. We demonstrate here that the Drosophila glypican Dally-like protein (Dlp) is required for proper axon guidance and visual-system function. Mosaic studies revealed that Dlp is necessary in both the retina and the brain for different aspects of visual-system assembly. Sdc mutants also showed axon guidance and visual-system defects, some that overlap with dlp and others that are unique. dlp+ transgenes were able to rescue some sdc visual-system phenotypes, but sdc+ transgenes were ineffective in rescuing dlp abnormalities. Together, these findings suggest that in some contexts HS chains provide the biologically critical component, whereas in others the structure of the protein core is also essential.

BackgroundHuman immunodeficiency virus type 2 (HIV-2) is often distinguished clinically by lower viral loads, reduced transmissibility, and longer asymptomatic periods than for human immunodeficiency virus type 1 (HIV-1). Differences in the mutation frequencies of HIV-1 and HIV-2 have been hypothesized to contribute to the attenuated progression of HIV-2 observed clinically.ResultsTo address this hypothesis, we performed Illumina sequencing of multiple amplicons prepared from cells infected with HIV-1 or HIV-2, resulting in ~4.7 million read pairs and the identification of ~200,000 mutations after data processing. We observed that: (1) HIV-2 displayed significantly lower total mutation, substitution, and transition mutation frequencies than that of HIV-1, along with a mutation spectrum markedly less biased toward G-to-A transitions, (2) G-to-A hypermutation consistent with the activity of APOBEC3 proteins was observed for both HIV-1 and HIV-2 despite the presence of Vif, (3) G-to-A hypermutation was significantly higher for HIV-1 than for HIV-2, and (4) HIV-1 and HIV-2 total mutation frequencies were not significantly different in the absence of G-to-A hypermutants.ConclusionsTaken together, these data demonstrate that HIV-2 exhibits a distinct mutational spectrum and a lower mutation frequency relative to HIV-1. However, the observed differences were primarily due to reduced levels of G-to-A hypermutation for HIV-2. These findings suggest that HIV-2 may be less susceptible than HIV-1 to APOBEC3-mediated hypermutation, but that the fidelities of other mutational sources (such as reverse transcriptase) are relatively similar for HIV-1 and HIV-2. Overall, these data imply that differences in replication fidelity are likely not a major contributing factor to the unique clinical features of HIV-2 infection.Electronic supplementary materialThe online version of this article (doi:10.1186/s12977-015-0180-6) contains supplementary material, which is available to authorized users.

The 3C-like protease (3CLpro) of SARS-CoV-2 is considered an excellent target for COVID-19 antiviral drug development because it is essential for viral replication and has a cleavage specificity distinct from human proteases. However, drug development for 3CLpro has been hindered by a lack of cell-based reporter assays that can be performed in a BSL-2 setting. Current efforts to identify 3CLpro inhibitors largely rely upon in vitro screening, which fails to account for cell permeability and cytotoxicity of compounds, or assays involving replication-competent virus, which must be performed in a BSL-3 facility. To address these limitations, we have developed a novel cell-based luciferase complementation reporter assay to identify inhibitors of SARS-CoV-2 3CLpro in a BSL-2 setting. The assay is based on a lentiviral vector that co-expresses 3CLpro and two luciferase fragments linked together by a 3CLpro cleavage site. 3CLpro-mediated cleavage results in a loss of complementation and low luciferase activity, whereas inhibition of 3CLpro results in 10-fold higher levels of luciferase activity. The luciferase reporter assay can easily distinguish true 3CLpro inhibition from cytotoxicity, a powerful feature that should reduce false positives during screening. Using the assay, we screened 32 small molecules for activity against SARS-CoV-2 3CLpro, including HIV protease inhibitors, HCV protease inhibitors, and various other compounds that have been reported to inhibit SARS-CoV-2 3CLpro. Of these, only five exhibited significant inhibition of 3CLpro in cells: GC376, boceprevir, Z-FA-FMK, calpain inhibitor XII, and GRL-0496. This assay should greatly facilitate efforts to identify more potent inhibitors of SARS-CoV-2 3CLpro.

Fluorescence fluctuation spectroscopy (FFS) quantifies the interactions of fluorescently-labeled proteins inside living cells by brightness analysis. However, the study of cytoplasmic proteins that interact with the plasma membrane is challenging with FFS. If the cytoplasmic section is thinner than the axial size of the observation volume, cytoplasmic and membrane-bound proteins are coexcited, which leads to brightness artifacts. This brightness bias, if not recognized, leads to erroneous interpretation of the data. We have overcome this challenge by introducing dual-color z-scan FFS and the addition of a distinctly colored reference protein. Here, we apply this technique to study the cytoplasmic interactions of the Gag proteins from human immunodeficiency virus type 1 (HIV-1) and human T-lymphotropic virus type 1 (HTLV-1). The Gag protein plays a crucial role in the assembly of retroviruses and is found in both membrane and cytoplasm. Dual-color z-scans demonstrate that brightness artifacts are caused by a dim nonpunctate membrane-bound fraction of Gag. We perform an unbiased brightness characterization of cytoplasmic Gag by avoiding the membrane-bound fraction and reveal previously unknown differences in the behavior of the two retroviral Gag species. HIV-1 Gag exhibits concentration-dependent oligomerization in the cytoplasm, whereas HTLV-1 Gag lacks significant cytoplasmic Gag-Gag interactions.

BackgroundHuman T-lymphotropic virus type 1 (HTLV-1) is an important human retrovirus that is a cause of adult T-cell leukemia/lymphoma. While an important human pathogen, the details regarding virus replication cycle, including the nature of HTLV-1 particles, remain largely unknown due to the difficulties in propagating the virus in tissue culture. In this study, we created a codon-optimized HTLV-1 Gag fused to an EYFP reporter as a model system to quantitatively analyze HTLV-1 particles released from producer cells.ResultsThe codon-optimized Gag led to a dramatic and highly robust level of Gag expression as well as virus-like particle (VLP) production. The robust level of particle production overcomes previous technical difficulties with authentic particles and allowed for detailed analysis of particle architecture using two novel methodologies. We quantitatively measured the diameter and morphology of HTLV-1 VLPs in their native, hydrated state using cryo-transmission electron microscopy (cryo-TEM). Furthermore, we were able to determine HTLV-1 Gag stoichiometry as well as particle size with the novel biophysical technique of fluorescence fluctuation spectroscopy (FFS). The average HTLV-1 particle diameter determined by cryo-TEM and FFS was 71 ± 20 nm and 75 ± 4 nm, respectively. These values are significantly smaller than previous estimates made of HTLV-1 particles by negative staining TEM. Furthermore, cryo-TEM reveals that the majority of HTLV-1 VLPs lacks an ordered structure of the Gag lattice, suggesting that the HTLV-1 Gag shell is very likely to be organized differently compared to that observed with HIV-1 Gag in immature particles. This conclusion is supported by our observation that the average copy number of HTLV-1 Gag per particle is estimated to be 510 based on FFS, which is significantly lower than that found for HIV-1 immature virions.ConclusionsIn summary, our studies represent the first quantitative biophysical analysis of HTLV-1-like particles and reveal novel insights into particle morphology and Gag stochiometry.