SUMMARYMutations that disrupt function of the human inwardly rectifying potassium channel KIR2.1 are associated with the craniofacial and digital defects of Andersen-Tawil Syndrome, but the contribution of Kir channels to development is undefined. Deletion of mouse Kir2.1 also causes cleft palate and digital defects. These defects are strikingly similar to phenotypes that result from disrupted TGF/BMP signaling. We use Drosophila melanogaster to show that a Kir2.1 homolog, Irk2, affects development by disrupting BMP signaling. Phenotypes of irk2 deficient lines, a mutant irk2 allele, irk2 siRNA and expression of a dominant-negative Irk2 subunit (Irk2DN) all demonstrate that Irk2 function is necessary for development of the adult wing. Compromised Irk2 function causes wingpatterning defects similar to those found when signaling through a Drosophila BMP homolog, Decapentaplegic (Dpp), is disrupted. To determine whether Irk2 plays a role in the Dpp pathway, we generated flies in which both Irk2 and Dpp functions are reduced. Irk2DN phenotypes are enhanced by decreased Dpp signaling. In wild-type flies, Dpp signaling can be detected in stripes along the anterior/posterior boundary of the larval imaginal wing disc. Reducing function of Irk2 with siRNA, an irk2 deletion, or expression of Irk2DN reduces the Dpp signal in the wing disc. As Irk channels contribute to Dpp signaling in flies, a similar role for Kir2.1 in BMP signaling may explain the morphological defects of Andersen-Tawil Syndrome and the Kir2.1 knockout mouse. DEVELOPMENT MATERIALS AND METHODS Maintenance of Drosophila stocksStocks were maintained on cornmeal food at 25°C or 18°C in a Percival incubator model 122 vL (Percival Scientific). Generation of the UAS-Irk2DN and UAS-Irk2WT fly strainsirk2A from Berlin w1118 fly cDNA was cloned into the EcoRI and XhoI sites of the pUAST vector. PCR was performed with cDNA template and primers (GGAATTCCATGCGTTTCAATTTCTCC and CCGCTCGAGCGGCTA -GGA GGCCTGGTCAGA) to add EcoRI and XhoI sites. Sequencing ensured fidelity of the construct. UAS-Irk2 DN was constructed by cutting irk2A out of UAS-irk2 WT with EcoRI and XhoI, and ligating into pET. The GYG of pET-Irk2A template plasmid was mutated to AAA using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) with the following primers: ACGCAGCACACTATTGCCGCTGCCGTCC-GAACCACCTCG and CGAGGTGGTTCGGACGGCAGCGGCAATA -GTGTGCTGCGT. Irk2-DN was removed from the pET vector with EcoRI and XhoI restriction enzymes and ligated into pUAST. All constructs were sequenced to verify the GYG to AAA mutations. We injected UAS-Irk2 WT or UAS-Irk2 DN plasmid with transposase DNA into 1-hour-old Berlin w1118 embryos. Matured injected flies were crossed to Berlin w1118 and progeny with the transgene were selected by eye color. irk1-AAA and irk3-AAA were generated with the same strategy using primer pairs: ACCCAGACGAC-GATAGCCGCTGCCAATC/CGTCACATAGCGATTGGCAGCGGCTA T -C (Irk1-AAA) and ATCGAGTCCAAGATACGAGTCTACATCATC/GAT-GATGTAGACTCGTATCTTGGACTCGATGGA (Irk3-AAA). Drosophila strainsT...
The β1 adrenergic receptor (β1AR) is recognized as a classical Gαs-coupled receptor. Agonist binding not only initiates G protein-mediated signaling but also signaling through the multifunctional adapter protein β-arrestin. Some βAR ligands, such as carvedilol, stimulate βAR signaling preferentially through β-arrestin, a concept known as β-arrestin-biased agonism. Here, we identify a signaling mechanism, unlike that previously known for any Gαs-coupled receptor, whereby carvedilol induces the transition of the β1AR from a classical Gαs-coupled receptor to a Gαi-coupled receptor stabilizing a distinct receptor conformation to initiate β-arrestin-mediated signaling. Recruitment of Gαi is not induced by any other βAR ligand screened, nor is it required for β-arrestin-bias activated by the β2AR subtype of the βAR family. Our findings demonstrate a previously unrecognized role for Gαi in β1AR signaling and suggest that the concept of β-arrestin-bias may need to be refined to incorporate the selective bias of receptors towards distinct G protein subtypes.
Loss of embryonic ion channel function leads to morphological defects, but the underlying reason for these defects remains elusive. Here, we show that inwardly rectifying potassium (Irk) channels regulate release of the bone morphogenetic protein Dpp in the developing fly wing and that this is necessary for developmental signaling. Inhibition of Irk channels decreases the incidence of distinct Dpp-GFP release events above baseline fluorescence while leading to a broader distribution of Dpp-GFP. Work by others in different cell types has shown that Irk channels regulate peptide release by modulating membrane potential and calcium levels. We found calcium transients in the developing wing, and inhibition of Irk channels reduces the duration and amplitude of calcium transients. Depolarization with high extracellular potassium evokes Dpp release. Taken together, our data implicate Irk channels as a requirement for regulated release of Dpp, highlighting the importance of the temporal pattern of Dpp presentation for morphogenesis of the wing.
During morphogenesis, cells communicate with each other to shape tissues and organs. Several lines of recent evidence indicate that ion channels play a key role in cellular signaling and tissue morphogenesis. However, little is known about the scope of specific ion-channel types that impinge upon developmental pathways. The Drosophila melanogaster wing is an excellent model in which to address this problem as wing vein patterning is acutely sensitive to changes in developmental pathways. We conducted a screen of 180 ion channels expressed in the wing using loss-of-function mutant and RNAi lines. Here we identify 44 candidates that significantly impacted development of the Drosophila melanogaster wing. Calcium, sodium, potassium, chloride, and ligand-gated cation channels were all identified in our screen, suggesting that a wide variety of ion channel types are important for development. Ion channels belonging to the pickpocket family, the ionotropic receptor family, and the bestrophin family were highly represented among the candidates of our screen. Seven new ion channels with human orthologs that have been implicated in human channelopathies were also identified. Many of the human orthologs of the channels identified in our screen are targets of common general anesthetics, anti-seizure and anti-hypertension drugs, as well as alcohol and nicotine. Our results confirm the importance of ion channels in morphogenesis and identify a number of ion channels that will provide the basis for future studies to understand the role of ion channels in development.
Proteins and peptides expressed in the prokaryotic system often form inclusion bodies. Solubilization and refolding procedures can be used for their recovery, but this process remains difficult. One strategy for improving the solubility of a protein of interest is to fuse it to a highly soluble protein. To select a suitable fusion partner capable of solubilizing the aggregation-prone (inclusion body-forming) proteins and peptides, Escherichia coli thermostable proteins were identified and tested. Among them, trigger factor (TF) protein was selected because of its high expression and stability. Using an expression system based on fusion to TF, selected proteins and peptides that otherwise form inclusion bodies were expressed in soluble state and were purified like other soluble proteins. This system provides a convenient method for production of aggregation-prone proteins and peptides.
The activity of caspase-2 was examined under varying biochemical conditions with the synthetic and protein substrates, Bid and procaspase-7. The results indicate that it was largely influenced by pH which might be one reason behind the inconsistency for the cleavage of its established substrates during caspase-2-induced apoptosis.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.