No abstract

No abstract

Genetically modified organisms (GMOs) are increasingly used in research and industrial systems to produce high-value pharmaceuticals, fuels, and chemicals1. Genetic isolation and intrinsic biocontainment would provide essential biosafety measures to secure these closed systems and enable safe applications of GMOs in open systems2,3, which include bioremediation4 and probiotics5. Although safeguards have been designed to control cell growth by essential gene regulation6, inducible toxin switches7, and engineered auxotrophies8, these approaches are compromised by cross-feeding of essential metabolites, leaked expression of essential genes, or genetic mutations9,10. Here, we describe the construction of a series of genomically recoded organisms (GROs)11 whose growth is restricted by the expression of multiple essential genes that depend on exogenously supplied synthetic amino acids (sAAs). We introduced a Methanocaldococcus jannaschii tRNA:aminoacyl-tRNA synthetase (aaRS) pair into the chromosome of a GRO that lacks all TAG codons and release factor 1, endowing this organism with the orthogonal translational components to convert TAG into a dedicated sense codon for sAAs. Using multiplex automated genome engineering (MAGE)12, we introduced in-frame TAG codons into 22 essential genes, linking their expression to the incorporation of synthetic phenylalanine-derived amino acids. Of the 60 sAA-dependent variants isolated, a notable strain harboring 3 TAG codons in conserved functional residues13 of MurG, DnaA and SerS and containing targeted tRNA deletions maintained robust growth and exhibited undetectable escape frequencies upon culturing ∼1011 cells on solid media for seven days or in liquid media for 20 days. This is a significant improvement over existing biocontainment approaches2,3,6-10. We constructed synthetic auxotrophs dependent on sAAs that were not rescued by cross-feeding in environmental growth assays. These auxotrophic GROs possess alternate genetic codes that impart genetic isolation by impeding horizontal gene transfer11 and now depend on the use of synthetic biochemical building blocks, advancing orthogonal barriers between engineered organisms and the environment.

No abstract

SUMMARYMutations that disrupt function of the human inwardly rectifying potassium channel KIR2.1 are associated with the craniofacial and digital defects of Andersen-Tawil Syndrome, but the contribution of Kir channels to development is undefined. Deletion of mouse Kir2.1 also causes cleft palate and digital defects. These defects are strikingly similar to phenotypes that result from disrupted TGF/BMP signaling. We use Drosophila melanogaster to show that a Kir2.1 homolog, Irk2, affects development by disrupting BMP signaling. Phenotypes of irk2 deficient lines, a mutant irk2 allele, irk2 siRNA and expression of a dominant-negative Irk2 subunit (Irk2DN) all demonstrate that Irk2 function is necessary for development of the adult wing. Compromised Irk2 function causes wingpatterning defects similar to those found when signaling through a Drosophila BMP homolog, Decapentaplegic (Dpp), is disrupted. To determine whether Irk2 plays a role in the Dpp pathway, we generated flies in which both Irk2 and Dpp functions are reduced. Irk2DN phenotypes are enhanced by decreased Dpp signaling. In wild-type flies, Dpp signaling can be detected in stripes along the anterior/posterior boundary of the larval imaginal wing disc. Reducing function of Irk2 with siRNA, an irk2 deletion, or expression of Irk2DN reduces the Dpp signal in the wing disc. As Irk channels contribute to Dpp signaling in flies, a similar role for Kir2.1 in BMP signaling may explain the morphological defects of Andersen-Tawil Syndrome and the Kir2.1 knockout mouse. DEVELOPMENT MATERIALS AND METHODS Maintenance of Drosophila stocksStocks were maintained on cornmeal food at 25°C or 18°C in a Percival incubator model 122 vL (Percival Scientific). Generation of the UAS-Irk2DN and UAS-Irk2WT fly strainsirk2A from Berlin w1118 fly cDNA was cloned into the EcoRI and XhoI sites of the pUAST vector. PCR was performed with cDNA template and primers (GGAATTCCATGCGTTTCAATTTCTCC and CCGCTCGAGCGGCTA -GGA GGCCTGGTCAGA) to add EcoRI and XhoI sites. Sequencing ensured fidelity of the construct. UAS-Irk2 DN was constructed by cutting irk2A out of UAS-irk2 WT with EcoRI and XhoI, and ligating into pET. The GYG of pET-Irk2A template plasmid was mutated to AAA using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) with the following primers: ACGCAGCACACTATTGCCGCTGCCGTCC-GAACCACCTCG and CGAGGTGGTTCGGACGGCAGCGGCAATA -GTGTGCTGCGT. Irk2-DN was removed from the pET vector with EcoRI and XhoI restriction enzymes and ligated into pUAST. All constructs were sequenced to verify the GYG to AAA mutations. We injected UAS-Irk2 WT or UAS-Irk2 DN plasmid with transposase DNA into 1-hour-old Berlin w1118 embryos. Matured injected flies were crossed to Berlin w1118 and progeny with the transgene were selected by eye color. irk1-AAA and irk3-AAA were generated with the same strategy using primer pairs: ACCCAGACGAC-GATAGCCGCTGCCAATC/CGTCACATAGCGATTGGCAGCGGCTA T -C (Irk1-AAA) and ATCGAGTCCAAGATACGAGTCTACATCATC/GAT-GATGTAGACTCGTATCTTGGACTCGATGGA (Irk3-AAA). Drosophila strainsT...

Background: Insulin stimulates endoproteolytic cleavage of TUG proteins to promote glucose uptake in cultured adipocytes, but the role of this pathway in muscle is uncharacterized. Results: Transgenic mice with constitutive and unregulated TUG cleavage in muscle had increased whole-body and musclespecific glucose uptake during fasting. Conclusion: Insulin acts through TUG to control glucose uptake in muscle. Significance: Understanding insulin action will elucidate diabetes pathogenesis.

Key pointsr STE20 (Sterile 20)/SPS-1 related proline/alanine-rich kinase (SPAK) and oxidative stress-response kinase-1 (OSR1) phosphorylate and activate the renal Na− cotransporter 2 (NKCC2) and Na + Cl − cotransporter (NCC).r Mouse models suggest that OSR1 mainly activates NKCC2-mediated sodium transport along the thick ascending limb, while SPAK mainly activates NCC along the distal convoluted tubule, but the kinases may compensate for each other. We hypothesized that disruption of both kinases would lead to polyuria and severe salt-wasting, and generated SPAK/OSR1 double knockout mice to test this.r Despite a lack of SPAK and OSR1, phosphorylated NKCC2 abundance was still high, suggesting the existence of an alternative activating kinase.r Compensatory changes in SPAK/OSR1-independent phosphorylation sites on both NKCC2and NCC and changes in sodium transport along the collecting duct were also observed.r Potassium restriction revealed that SPAK and OSR1 play essential roles in the emerging model that NCC activation is central to sensing changes in plasma [Abstract STE20 (Sterile 20)/SPS-1 related proline/alanine-rich kinase (SPAK) and oxidative stress-response kinase-1 (OSR1) activate the renal cation cotransporters Na− cotransporter (NKCC2) and Na + -Cl − cotransporter (NCC) via phosphorylation. Knockout mouse models suggest that OSR1 mainly activates NKCC2, while SPAK mainly activates NCC, with possible cross-compensation. We tested the hypothesis that disrupting both kinases causes severe polyuria and salt-wasting by generating SPAK/OSR1 double knockout (DKO) mice. DKO mice displayed lower systolic blood pressure compared with SPAK knockout (SPAK-KO) mice, but displayed no severe phenotype even after dietary salt restriction. Phosphorylation of NKCC2 at SPAK/OSR1-dependent sites was lower than in SPAK-KO mice, but still significantly greater than in wild type mice. In the renal medulla, there was significant phosphorylation of NKCC2 at SPAK/OSR1-dependent sites despite a complete absence of SPAK and OSR1, suggesting the existence of an alternative activating kinase. The distal convoluted tubule has been proposed to sense plasma [K + ], with NCC activation serving as the primary effector pathway that modulates K + secretion, by metering sodium delivery to the collecting duct. Abundance of phosphorylated NCC (pNCC) is dramatically lower in SPAK-KO mice than in wild type mice, and the additional

Insulin resistance drives the development of type 2 diabetes (T2D). In liver, diacylglycerol (DAG) is a key mediator of lipid-induced insulin resistance. DAG activates protein kinase C ε (PKCε), which phosphorylates and inhibits the insulin receptor. In rats, a 3-day high-fat diet produces hepatic insulin resistance through this mechanism, and knockdown of hepatic PKCε protects against high-fat diet-induced hepatic insulin resistance. Here, we employed a systems-level approach to uncover additional signaling pathways involved in high-fat diet-induced hepatic insulin resistance. We used quantitative phosphoproteomics to map global in vivo changes in hepatic protein phosphorylation in chow-fed, high-fat-fed, and high-fat-fed with PKCε knockdown rats to distinguish the impact of lipid- and PKCε-induced protein phosphorylation. This was followed by a functional siRNA-based screen to determine which dynamically regulated phosphoproteins may be involved in canonical insulin signaling. Direct PKCε substrates were identified by motif analysis of phosphoproteomics data and validated using a large-scale in vitro kinase assay. These substrates included the p70S6K substrates RPS6 and IRS1, which suggested cross talk between PKCε and p70S6K in high-fat diet-induced hepatic insulin resistance. These results identify an expanded set of proteins through which PKCε may drive high-fat diet-induced hepatic insulin resistance that may direct new therapeutic approaches for T2D.