HIV-1 capsid core disassembly (uncoating) must occur before integration of viral genomic DNA into the host chromosomes, yet remarkably, the timing and cellular location of uncoating is unknown. Previous studies have proposed that intact viral cores are too large to fit through nuclear pores and uncoating occurs in the cytoplasm in coordination with reverse transcription or at the nuclear envelope during nuclear import. The capsid protein (CA) content of the infectious viral cores is not well defined because methods for directly labeling and quantifying the CA in viral cores have been unavailable. In addition, it has been difficult to identify the infectious virions because only one of ∼50 virions in infected cells leads to productive infection. Here, we developed methods to analyze HIV-1 uncoating by direct labeling of CA with GFP and to identify infectious virions by tracking viral cores in living infected cells through viral DNA integration and proviral DNA transcription. Astonishingly, our results show that intact (or nearly intact) viral cores enter the nucleus through a mechanism involving interactions with host protein cleavage and polyadenylation specificity factor 6 (CPSF6), complete reverse transcription in the nucleus before uncoating, and uncoat <1.5 h before integration near (<1.5 μm) their genomic integration sites. These results fundamentally change our current understanding of HIV-1 postentry replication events including mechanisms of nuclear import, uncoating, reverse transcription, integration, and evasion of innate immunity.

Transforming growth factor-betas (TGF-beta) comprise a superfamily of secreted proteins with diverse functions in patterning and cell division control. TGF-beta signaling has been implicated in synapse assembly and plasticity in both vertebrate and invertebrate systems. Recently, wishful thinking, a Drosophila gene that encodes a protein related to BMP type II receptors, has been shown to be required for the normal function and development of the neuromuscular junction (NMJ). These findings suggest that a TGF-beta-related ligand activates a signaling cascade involving type I and II receptors and the Smad family of transcription factors to orchestrate the assembly of the NMJ. Here we demonstrate that the TGF-beta type I receptor Saxophone and the downstream transcription factor Mothers against dpp (Mad) are essential for the normal structural and functional development of the Drosophila NMJ, a synapse that displays activity-dependent plasticity.

SUMMARYMutations that disrupt function of the human inwardly rectifying potassium channel KIR2.1 are associated with the craniofacial and digital defects of Andersen-Tawil Syndrome, but the contribution of Kir channels to development is undefined. Deletion of mouse Kir2.1 also causes cleft palate and digital defects. These defects are strikingly similar to phenotypes that result from disrupted TGF/BMP signaling. We use Drosophila melanogaster to show that a Kir2.1 homolog, Irk2, affects development by disrupting BMP signaling. Phenotypes of irk2 deficient lines, a mutant irk2 allele, irk2 siRNA and expression of a dominant-negative Irk2 subunit (Irk2DN) all demonstrate that Irk2 function is necessary for development of the adult wing. Compromised Irk2 function causes wingpatterning defects similar to those found when signaling through a Drosophila BMP homolog, Decapentaplegic (Dpp), is disrupted. To determine whether Irk2 plays a role in the Dpp pathway, we generated flies in which both Irk2 and Dpp functions are reduced. Irk2DN phenotypes are enhanced by decreased Dpp signaling. In wild-type flies, Dpp signaling can be detected in stripes along the anterior/posterior boundary of the larval imaginal wing disc. Reducing function of Irk2 with siRNA, an irk2 deletion, or expression of Irk2DN reduces the Dpp signal in the wing disc. As Irk channels contribute to Dpp signaling in flies, a similar role for Kir2.1 in BMP signaling may explain the morphological defects of Andersen-Tawil Syndrome and the Kir2.1 knockout mouse. DEVELOPMENT MATERIALS AND METHODS Maintenance of Drosophila stocksStocks were maintained on cornmeal food at 25°C or 18°C in a Percival incubator model 122 vL (Percival Scientific). Generation of the UAS-Irk2DN and UAS-Irk2WT fly strainsirk2A from Berlin w1118 fly cDNA was cloned into the EcoRI and XhoI sites of the pUAST vector. PCR was performed with cDNA template and primers (GGAATTCCATGCGTTTCAATTTCTCC and CCGCTCGAGCGGCTA -GGA GGCCTGGTCAGA) to add EcoRI and XhoI sites. Sequencing ensured fidelity of the construct. UAS-Irk2 DN was constructed by cutting irk2A out of UAS-irk2 WT with EcoRI and XhoI, and ligating into pET. The GYG of pET-Irk2A template plasmid was mutated to AAA using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) with the following primers: ACGCAGCACACTATTGCCGCTGCCGTCC-GAACCACCTCG and CGAGGTGGTTCGGACGGCAGCGGCAATA -GTGTGCTGCGT. Irk2-DN was removed from the pET vector with EcoRI and XhoI restriction enzymes and ligated into pUAST. All constructs were sequenced to verify the GYG to AAA mutations. We injected UAS-Irk2 WT or UAS-Irk2 DN plasmid with transposase DNA into 1-hour-old Berlin w1118 embryos. Matured injected flies were crossed to Berlin w1118 and progeny with the transgene were selected by eye color. irk1-AAA and irk3-AAA were generated with the same strategy using primer pairs: ACCCAGACGAC-GATAGCCGCTGCCAATC/CGTCACATAGCGATTGGCAGCGGCTA T -C (Irk1-AAA) and ATCGAGTCCAAGATACGAGTCTACATCATC/GAT-GATGTAGACTCGTATCTTGGACTCGATGGA (Irk3-AAA). Drosophila strainsT...

Heparan sulfate proteoglycans (HSPGs), a class of glycosaminoglycan-modified proteins, control diverse patterning events via their regulation of growth-factor signaling and morphogen distribution. In C. elegans, zebrafish, and the mouse, heparan sulfate (HS) biosynthesis is required for normal axon guidance, and mutations affecting Syndecan (Sdc), a transmembrane HSPG, disrupt axon guidance in Drosophila embryos. Glypicans, a family of glycosylphosphatidylinositol (GPI)-linked HSPGs, are expressed on axons and growth cones in vertebrates, but their role in axon guidance has not been determined. We demonstrate here that the Drosophila glypican Dally-like protein (Dlp) is required for proper axon guidance and visual-system function. Mosaic studies revealed that Dlp is necessary in both the retina and the brain for different aspects of visual-system assembly. Sdc mutants also showed axon guidance and visual-system defects, some that overlap with dlp and others that are unique. dlp+ transgenes were able to rescue some sdc visual-system phenotypes, but sdc+ transgenes were ineffective in rescuing dlp abnormalities. Together, these findings suggest that in some contexts HS chains provide the biologically critical component, whereas in others the structure of the protein core is also essential.