Padi (Oryza sativa L.) merupakan salah satu tanaman pertanian penting di dunia. Penyakit hawar daun bakteri yang disebabkan oleh Xanthomonas oryzae merupakan salah satu penyakit pada tanaman padi. Untuk mengatasi penyakit hawar daun bakteri pada padi umumnya menggunakan bakterisida kimiawi, agens hayati, kitosan dan penggunaan varietas tahan, tetapi penggunaan bakterisida kimiawi yang terus menerus dapat mencemari lingkungan. Pemanfaatan tanaman yang berpotensi sebagai baterisida ramah lingkungan seperti daun sirih dan lengkuas dapat dijadikan sebagai salah satu alternatif pengendalian penyakit hawar daun bakteri. Penelitian ini bertujuan untuk mengetahui interaksi antara pengaruh jenis ekstrak dan frekuensi aplikasi terhadap komponen patosistem dan komponen pertumbuhan terhadap penyakit hawar daun bakteri pada padi. Penelitian menggunakan Rancangan Acak Kelompok (RAK) yang terdiri dari 2 faktor. Faktor pertama yaitu jenis perlakuan (P) yang terdiri dari aquadest (kontrol) (P0), ekstrak daun sirih (P1), dan ekstrak lengkuas (P2), dan faktor kedua adalah frekuensi aplikasi terdiri dari 1 kali/minggu (F1), 2 kali/minggu (F2), dan 3 kali/minggu (F3). Terdapat 9 kombinasi perlakuan dengan 3 kali ulangan, setiap petak percobaan terdiri dari 3 tanaman, sehingga jumlah keseluruhan sampel yang diamati pada penelitian sebanyak 81 unit percobaan. Hasil menunjukkan bahwa ekstrak lengkuas merupakan perlakuan ekstrak terbaik dalam menekan penyakit hawar daun bakteri dibandingkan dengan ekstrak daun sirih dan kontrol, dengan keparahan penyakit paling rendah yaitu 46,46% dan efikasi 24%, ekstrak lengkuas memiliki pengaruh nyata terhadap tinggi tanaman, berat bulir, dan panjang akar pada tanaman padi.
Abstrak: Jenis data yang digunakan dalam penelitian ini adalah berupa data sekunder yaitu berupa data yang diperoleh berbagai sumber instansi yang terdiri dari Badan Pusat Statistik (BPS), Kabupaten Padang Pariaman dalam angka 2020, kemudian data suhu dan kelembaban 10 tahun terakhir, data produk unggulan (pertanian, perkebunan, hortikultura) Kabupaten Padang Pariaman tersebut diolah ke dalam microsoft excel, dan data berupa kebutuhan pupuk pada komuditas unggul tersebut. Kabupaten Padang Pariaman mempunyai iklim tropis dengan suhu maksimum rata-rata sebesar 25,7°C, sedangkan rata-rata kelembaban pada kabupaten Padang Pariaman memiliki tingkat kelembaban 86,4%. Dengan kondisi iklim suhu dan kelembabantersebut, terdapat beberapa jenis komoditas unggulan pertanian pada kabupaten tersebut seperti padi, dan ubi kayu. Pada komoditas unggulan perkebunan yaitu tanaman kakao, kelapa sawit dan karet, sedangkan komoditas unggulan hortikultura adalah duku, terung, danmanggis. Pemupukan dilakukan harus sesuai dengan kebutuhan dari masing-masing tanaman dan cara pemberian harus tepat agar tidak merugikan dan tidak merusak lingkungan akibat kelebihan konsentrasi serta waktu dan cara aplikasinya.
One of the important diseases in rice is the Bacterial Leaf Blight (HDB) or the so-called kresek disease caused by Xanthomonas oryzae pv. oryzae. This disease is one of the main diseases of rice in Indonesia. This is supported by agricultural conditions in hot and humid tropical areas so that disease development is more optimal. The purpose of this study was to determine the efficacy of betel leaf extract and some rhizomes in suppressing the growth of Xanthomonas oryzae pv. oryzae in-vitro scale. The research was conducted at the Center for Forecasting Plant Pest Organisms (BBPOPT), Karawang, West Java. The extracts of galangal, turmeric, and betel were prepared at concentrations of 10, 15, and 25%, the method used was a scatter plate by taking 10, 50, and 100 μL of Xoo isolate liquid, holding the petri dish to a bunsen fire, and spraying Xoo isolates liquid. into a petri dish containing PSA media + rhizome extract, the dispersing tool used is drigalski. The results of daily observations of rhizome extract antagonist testing on Xoo growth showed that the treatment of betel leaf extract with a concentration of 10%, 15%, and 25% had a high bacterial inhibitory value compared to other treatments with 100% inhibition, whereas in the control treatment (only PSA media) shows that it does not have bacterial inhibition, and the galangal rhizome extract treatment has the highest inhibitory power when compared to other treatments on 100 μL of Xoo bacterial suppression.
Hawar daun bakteri (HDB) merupakan salah satu penyakit penting tanaman padi dengan kehilangan hasil mencapai 15-80%. Manipulasi iklim mikro melalui teknik pola tanam menjadi salah satu upaya pengendalian penyakit ini. Oleh karena itu, pada penelitian ini akan diidentifikasi penyebab penyakit HDB pada kombinasi pola tanam system of rice intensification (SRI) dan jajar legowo. Penelitian dilakukan di Balai Besar Peramalan Organisme Pengganggu Tanaman (BBPOPT), Jatisari, Karawang mulai bulan Agustus sampai September 2020. Kombinasi pola tanaman terdiri dari (1) SRI dengan kombinasi jarwo 2:1, (2) SRI dengan kombinasi jarwo 3:1, (3) SRI dengan kombinasi jarwo 4:1, (4) SRI dengan kombinasi jarwo 5:1, (5) SRI tanpa kombinasi, dan (6) Sistem tanem tegal (konvensional). Setiap petak kemudian dibagi menjadi 5 subpetak sebagai ulangan (1 titik di setiap sudut petak dan 1 titik di tengah-tengah petak). Gejala, kejadian dan keparahan penyakit diamati pada masing-masing subpetak. Tanaman yang menunjukkan gejala kemudian diidentifikasi secara molekuler dengan teknik polymerase chain reaction (PCR) meliputi proses ekstraksi total DNA dan amplifikasi nukleotida dengan menggunakan pasangan primer forward (F:CCTCTATGAGTCGGGAGCTG) dan primer reverse (R: ACACCGTGATGCAATGAAGA). Hasil pengamatan menunjukkan gejala berupa bercak abu-abu di tepi daun kemudian berkembang ke arah pangkal daun baik di satu atau dua sisi daun. Selanjutnya daun menjadi tidak beraturan dan mengering. Kejadian penyakit HDB sebesar 81.67 – 95%, sedangkan keparahan penyakit sebesar 27.97 – 42.44% disemua pola tanaman. Identifikasi dengan teknik PCR menunjukkan bahwa penyebab penyakit HDB adalah Xanthomonas oryzae pv. oryzae yang teramplifikasi pada band ukuran 230 – 250 bp.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.