Chaetomium globosum Kunze, has been identified as a potential antagonist of Cochliobolus sativus (S. Ito & Kurib.) Deschler ex Dastur. (Syn = Drechslera sorokiniana). Production of antifungal compounds by Chaetomium globosum (Cg) and their role in suppression of spot blotch of wheat caused by this fungus under in vitro and in vivo has been evaluated. Interaction between Chaetomium globosum isolates and C. sativus showed mycoparasitism by isolates Cg 1 and Cg 6 whereas isolates Cg 2, Cg 3, Cg 4 and Cg 5 showed antibiosis. Syringe filtered culture extracts of Cg 2 completely inhibited mycelial growth of C. sativus in liquid broth. In vitro bioassays were undertaken by amending the medium with crude extracts and agar diffusion method in order to assess the fungistatic activity of crude extracts from culture filtrates of different isolates of Chaetomium globosum. Significant differences in antagonism between isolates were observed. Antifungal metabolite profiling, on TLC (Thin Layer Chromatography) plates identified 13 compounds in isolate Cg 2, 11 compounds in Cg 3 and 7 compounds in Cg 6. Isolate Cg 1 produced only two faint bands and Cg 5 produced two bands of the same Rf value but of higher intensity. The production of antifungal compounds by isolates was positively correlated with antagonism to C. sativus on seedlings in glasshouse studies. The results showed high antifungal metabolite production by isolate Cg 2, which also gave maximum bioefficacy under laboratory and glasshouse conditions.

No abstract

Nineteen isolates of Rhizoctonia solani collected from different rice varieties grown in various regions of Punjab were studied for their morphological and pathological characterization. Majority of the isolates were fast growing with raised and fluffy colonies and hyphal width of 9.6 lm while four exhibited moderate growth rate. Colony colour in all except two isolates was light yellowish brown. While sclerotial number per 5.0 mm culture disc of the test isolates ranged between 2.1 and 11.2 mm, their size varied between 1.31 and 2.08 mm. Sclerotial colour in all except two isolates was dark brown and most of these were found scattered in the colony. There was no relationship between morphologically similar isolates and their pathogenic behaviour. Majority of the isolates produced lesion length between 45.6 and 58.2 mm on detached rice leaves (cv. PR116). Molecular characterization of genetic diversity in the test isolates was studied by using 10 inter simple sequence repeats (ISSR) and eight random amplified polymorphic DNA (RAPD) markers. The size of amplified DNA bands ranged from 0.25-3.0 to 0.5-4.0 kb with ISSR and RAPD markers, respectively. Combined data set of 155 DNA markers were analysed with UPGMA resulting five clusters with 49-89% genetic similarity. Most of the isolates showed grouping specific to the host variety. Out of these two types of DNA markers, RAPD markers were able to detect more genetic variability when compared to ISSR markers.

Fusarium fujikuroi causing bakanae disease has emerged as one of the major pathogen of rice across the world. The study aims to comparative genomic analysis of Fusarium fujikuroi isolates and identification of the secretary proteins of the fungus involved in rice pathogenesis. In the present study, F. fujikuroi isolate “F250” was sequenced with an assembly size of 42.47 Mb providing coverage of 96.89% on reference IMI58289 genome. A total of 13,603 protein-coding genes were predicted from genome assembly. The average gene density in the F. fujikuroi genome was 315.10 genes per Mb with an average gene length of 1.67 kb. Additionally, 134,374 single nucleotide polymorphisms (SNPs) are identified against IMI58289 isolate, with an average SNP density of 3.11 per kb of genome. Repetitive elements represent approximately 270,550 bp, which is 0.63% of the total genome. In total, 3,109 simple sequence repeats (SSRs), including 302 compound SSRs are identified in the 8,656 scaffolds. Comparative analysis of the isolates of F. fujikuroi revealed that they shared a total of 12,240 common clusters with F250 showing higher similarity with IMI58289. A total of 1,194 secretory proteins were identified in its genome among which there were 356 genes encoding carbohydrate active enzymes (CAZymes) capable for degradation of complex polysaccharides. Out of them glycoside hydrolase (GH) families were most prevalent (41%) followed by carbohydrate esterase (CE). Out of them CE8 (4 genes), PL1 (10 genes), PL3 (5 genes), and GH28 (8 genes) were prominent plant cell wall degrading enzymes families in F250 secretome. Besides this, 585 genes essential for the pathogen–host interactions were also identified. Selected genes were validated through quantitative real-time PCR analyses in resistant and susceptible genotypes of rice at different days of inoculation. The data offers a better understanding of F. fujikuroi genome and will help us enhance our knowledge on Fusarium fujikuroi–rice interactions.

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPsÕ) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5¢GTGTGCGATCAGTTGCTGGG3¢) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.

Tilletia indica is an internationally quarantined fungal pathogen causing Karnal bunt of wheat. The present study carried out that the whole genome of T. indica was sequenced and identified transposable elements, pathogenicity-related genes using a comparative genomics approach. The T. indica genome assembly size of 33.7 MB was generated using Illumina and Pac Bio platforms with GC content of 55.0%. A total of 1737 scaffolds were obtained with N 50 of 58,667 bp. The ab initio gene prediction was performed using Ustilago maydis as the reference species. A total number of 10,113 genes were predicted with an average gene size of 1945 bp out of which functionally annotated genes were 7262. A total number of 3216 protein-coding genes were assigned in different categories. Out of a total number of 1877 transposable elements, gypsy had the highest count (573). Total 5772 simple sequence repeats were identified in the genome assembly, and the most abundant simple sequence repeat type was trinucleotide having 42% of total SSRs. The comparative genome analysis suggested 3751 proteins of T. indica had orthologs in five fungi, whereas 126 proteins were unique to T. indica. Secretome analysis revealed the presence of 1014 secretory proteins and few carbohydrate-active enzymes in the genome. Some putative candidate pathogenicity-related genes were identified in the genome. The whole genome of T. indica will provide a window to understand the pathogenesis mechanism, fungal life cycle, survival of teliospores, and novel strategies for management of Karnal bunt disease of wheat.

Tilletia indica Mitra is the causal agent of Karnal bunt of wheat, an important disease prevalent in several countries. The disease is internationally quarantined and the pathogen due to its heterothallic nature shows high variability. In the present study, we compared the pathogenic behaviour of various isolates of T. indica collected from different geographical locations of India and genetically characterized monosporidial (Ms) culture lines raised from these isolates of the pathogen. Pathogenic variability revealed existence of three pathotypes based on aggressiveness on a set of differential host genotypes. Monosporidial culture lines viz., 5 each from KB1, KB2, KB4 and KB5 and three lines of KB3 were established and analyzed genetically using 12 Universal Rice Primers (URPs). Amplification showed 98.44% polymorphism and primer URP 13R produced 100% polymorphic bands. Maximum similarity (83%) was between KB1MsB and KB1MsD as calculated by Jaccard's similarity coefficient, whereas, minimum similarity was between KB1MsC and KB4MsB; KB1MsE and KB3MsA (46%). Three groups were formed among all Ms culture lines. One major group consisted of 13 lines with approximately 70% similarity, the second group consisted of 7 culture lines showing 55% similarity and the third group consisted of 3 Ms lines. URPs were able to differentiate the Ms culture lines raised from different T. indica isolates and the results indicated heterogeneity in the pathogen population.

No abstract