The overzealous and indiscriminate use of most of the synthetic fungicides has created different types of environmental and toxicological problems. Recently, in different parts of the world, attention has been paid towards exploitation of higher plant products as novel chemotherapeutants in plant protection. The popularity of botanical pesticides is once again increasing and some plant products are being used globally as green pesticides. Pyrethroids and neem products are well established commercially as botanical pesticides and recently some essential oils of higher plants have also been used as antimicrobials against storage pests because of their relatively safe status and wide acceptance by the consumers. Some of the volatile oils, which often contain the principal aromatic and flavouring components of herbs and spices, have been recommended as plant based antimicrobials to retard microbial contamination and reduction in spoilage of food commodities. In the context of agricultural pest management, botanical pesticides are best suited for use in organic food production in industrialized countries but can play a much greater role in the production and post harvest protection of food products in developing countries

No abstract

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPsÕ) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5¢GTGTGCGATCAGTTGCTGGG3¢) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.

Tilletia indica is an internationally quarantined fungal pathogen causing Karnal bunt of wheat. The present study carried out that the whole genome of T. indica was sequenced and identified transposable elements, pathogenicity-related genes using a comparative genomics approach. The T. indica genome assembly size of 33.7 MB was generated using Illumina and Pac Bio platforms with GC content of 55.0%. A total of 1737 scaffolds were obtained with N 50 of 58,667 bp. The ab initio gene prediction was performed using Ustilago maydis as the reference species. A total number of 10,113 genes were predicted with an average gene size of 1945 bp out of which functionally annotated genes were 7262. A total number of 3216 protein-coding genes were assigned in different categories. Out of a total number of 1877 transposable elements, gypsy had the highest count (573). Total 5772 simple sequence repeats were identified in the genome assembly, and the most abundant simple sequence repeat type was trinucleotide having 42% of total SSRs. The comparative genome analysis suggested 3751 proteins of T. indica had orthologs in five fungi, whereas 126 proteins were unique to T. indica. Secretome analysis revealed the presence of 1014 secretory proteins and few carbohydrate-active enzymes in the genome. Some putative candidate pathogenicity-related genes were identified in the genome. The whole genome of T. indica will provide a window to understand the pathogenesis mechanism, fungal life cycle, survival of teliospores, and novel strategies for management of Karnal bunt disease of wheat.

No abstract

Chaetomium globosum Kunze is recognized as a potential biocontrol fungus against spot blotch of wheat caused by Bipolaris sorokiniana. Its molecular mechanism of biocontrol activity and the biosynthetic pathways involved have not been yet elucidated. Here, global transcriptome profiling of C. globosum strain Cg2 during interaction with B. sorokiniana isolate BS112 using RNA-seq was performed in order to gain insights into the potential mechanisms of antagonism. The Illumina HiSeq platform (2 × 150 bp) yielded an average of 20–22 million reads with 50–58% GC. De novo assembly generated 45,582 transcripts with 27,957 unigenes. Transcriptome analysis displayed distinct expression profiles in the interaction (Cg2–BS112), out of which 6,109 unique differentially expressed genes were present. The predominant transcripts classified as genes involved in “catalytic activity” constituted 45.06%, of which 10.02% were associated with “hydrolytic activity” (GO:0008152), and similarly, in the biological process, 29.18% of transcripts were involved in “metabolic activity” (GO:0004096 and GO:0006979). Heat map and cluster categorization suggested an increase in the expression levels of genes encoding secondary metabolites like polyketide synthase (GO:0009058), S-hydroxymethyl glutathione dehydrogenase (GO:0006069), terpene cyclase (EC 4.2.3.-), aminotran_1_2 domain-containing protein (GO:0009058), and other hydrolytic CAZYmes such as the glycosyl hydrolase (GH) family (GH 13, GH 2, GH 31, and GH 81; GO:0005975), cellulase domain-containing protein, chitinases, β-1, 3-glucanases (GO:0004565), glucan endo-1,3-beta-glucanase (GO:0052861), and proteases (GO:0004177). The obtained RNA-seq data were validated by RT-qPCR using 20 randomly chosen genes, showing consistency with the RNA-seq results. The present work is worldwide the first effort to unravel the biocontrol mechanism of C. globosum against B. sorokiniana. It generated a novel dataset for further studies and facilitated improvement of the gene annotation models in the C. globosum draft genome.

No abstract

Bipolaris sorokiniana is a devastating fungal pathogen causing spot blotch of wheat. We report here the first draft genome of Bipolaris sorokiniana strain BS_112 from India using sequence reads from the Ion Torrent, Illumina HiSeq, and Nanopore platforms. The genome size was estimated at 35.64 Mb with an average G+C content of 50.20%.