Antibacterial activity of indigenous Dayak onion (Eleutherine palmifolia (L.) Merr) was investigated. The Dayak onion was solvent extracted with n-hexane, ethyl acetate, and ethanol 96% consecutively. Each extract was tested its antibacterial activity towards methicillin-resistant Staphylococcus aureus (MRSA), Bacillus cereus, Shigella sp., and Pseudomonas aeruginosa using disc diffusion method. The test results showed that the n-hexane, ethyl acetate, and ethanol 96% extracts positively inhibited the growth of MRSA, B. cereus, Shigella sp., and P. aeruginosa. The highest inhibition activity of each extract was obtained with 10 mg/mL of extract concentration; whereas the minimum inhibitory concentration (MIC) of each extract was 2 mg/mL. Extract with the highest inhibition activity was ethyl acetate extract against B. cereus (139.58%). TLC evaluation of ethyl acetate extract showed four spots and bioautography indicated that ethyl acetate extract contained four types of compounds with inhibition activity against B. cereus, in which two compounds have higher antibacterial activity than the other two.
Bifidobacteria belongs to the so-called beneficial intestinal flora. Before attempting to raise their intestinal levels to improve the health status of the host, it is importance to know about physiological variations in the Bifidobacterial colonization of the human intestine. Birth process influenced the diversity of Bifidobacteria in infant feces. This research was intended to isolate and characterize Bifidobacterium spp. as well to evaluate their presence in the feces of infants who were born by mode of normal, caesarean and premature. The research was conducted by survey method and data were analyzed with descriptive analysis. Bifidobacterium character was observed include colony and cell morphology. The biochemical test included catalase, oxidase, indole, Voges-Proskauer, different pH growth, and resistance to lysozyme. Bifidobacterium metabolites obtained tested its bacterial activity to Salmonella typhimurium and Escherichia coli. The result of this research showed that 35 isolates are suspected Bifidobacterium group and after API 20 A test showed 17 isolates are rally genera of Bifidobacterium spp.and all isolates come from infant feces with caesar and premature delivery. These isolates inhibited the growth of S. typhimurium and E. coli with different inhibitory capabilities. This finding is very important for science and medical point of view and could be developed with further research.
Lipases are valuable biocatalysts because they act under extremely mild conditions, are stable in organic solvents, show broad substrate specificity and exhibit high stereoselectivity. Lipases play important role in various industries such as detergent, cosmetics, flavor, pharmacy and synthesis of organic compounds. The increasing of lipases requirements in industries is goading research to get new lipases resources commited. One of potential lipase resource is Azospirillum sp.JG3 bacteria from Microbiology Laboratory of Biology Faculty University of Jenderal Soedirman. The specific targets of this research are to get crude extract of lipase and investigate its biochemical characteristics. The method used were rejuvenation of Azospirillum sp.JG3 bacteria, inoculum production, determination of optimum production time and bacterium growth phase, extraction and production of lipase to get crude extract, and characterization the biochemical properties of lipase crude extract. The research resulted that crude extract of lipase from Azospirillum sp.JG3 had optimum temperature at 40 °C and optimum pH at pH 7. The lipase was a metalloenzyme with Ca 2+ as its cofactor. The lipase was stable in three organic solvents tested, (chloroform, n-hexane and ether).
Alcaligenes faecalis, is an opportunistic, pathogenic, Gram‐negative, food‐borne bacterium appearing to be of public health importance due to its resistance to common antibiotics and frequent involvement in nosocomial infections and water contamination. Yet, the Betaproteobacterium showed potential benefit in fat degradation of food waste. It is suggested that pterin‐based Molybdenum cofactor (Moco) biosynthesis involving moa gene is related with the pathogenesis of several Gram‐negative bacteria, while in addition to lipase genes, glycerol coding genes including glpD are involved in effective degradation of fat waste. In this study, a degenerate colony and an arbitrary PCR‐based methods were involved in gene isolation steps. We designed a pair of degenerate primers to detect moaC (GMF: 5′‐ATCGGCATCACCAACCAGC‐3′ and GMR: 5′‐TGTCGATGGTGCCGAAGC‐3′) and two gene specific primers to amplify 5′ (5′‐TGATGAATGTTCCGTTGCGCTGCC‐3′) and 3′ (5′‐GACCTGCAGGCATGCAAGCTCGGC‐3′) ends of glpD of strain JG3 using degenerate colony and arbitrary PCR methods, respectively. The developed degenerate colony PCR resulted amplification of targeted 421‐bp DNA, while the set arbitrary PCR resulted in non‐targeted 436‐bp DNA. Deduced amino acid analysis showed that both sequences shared 94% amino acid similarity with molybdenum cofactor biosynthesis (MoaC) of Pseudomonas stutzeri and benzoate membrane transporter (BenE) of A. faecalis, respectively. Practical applications It is suggested that pterin‐based Molybdenum cofactor (Moco) biosynthesis involving moa gene is related with the pathogenesis of several Gram‐negative bacteria, while in addition to lipase genes, glycerol coding genes including glpD are involved in effective degradation of fat waste. However, information about these genes in pathogenic, food‐borne, Gram‐negative Alcaligenes sp. JG3 bacterium originated from root of Zea mays is barely found. A pair of degenerate primers (GMF: 5′‐ATCGGCATCACCAACCAGC‐3′ and GMR: 5′‐TGTCGATGGTGCCGAAGC‐3′) designed in this study could detect 421‐bp moaC gene fragment using degenerate colony PCR, while another pair of gene specific primers 5′ (5′‐TGATGAATGTTCCGTTGCGCTGCC‐3′) and 3′ (5′‐GACCTGCAGGCATGCAAGCTCGGC‐3′) aiming to amplify ends of glpD of Alcaligenes sp. JG3 detected a nontargeted, 436‐bp benE gene of the strain using an arbitrary PCR method.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.