Characterization of moaC and a nontarget gene fragments of food‐borne pathogen Alcaligenes sp. JG3 using degenerate colony and arbitrary PCRs

Abstract

Alcaligenes faecalis, is an opportunistic, pathogenic, Gram‐negative, food‐borne bacterium appearing to be of public health importance due to its resistance to common antibiotics and frequent involvement in nosocomial infections and water contamination. Yet, the Betaproteobacterium showed potential benefit in fat degradation of food waste. It is suggested that pterin‐based Molybdenum cofactor (Moco) biosynthesis involving moa gene is related with the pathogenesis of several Gram‐negative bacteria, while in addition to lipase genes, glycerol coding genes including glpD are involved in effective degradation of fat waste. In this study, a degenerate colony and an arbitrary PCR‐based methods were involved in gene isolation steps. We designed a pair of degenerate primers to detect moaC (GMF: 5′‐ATCGGCATCACCAACCAGC‐3′ and GMR: 5′‐TGTCGATGGTGCCGAAGC‐3′) and two gene specific primers to amplify 5′ (5′‐TGATGAATGTTCCGTTGCGCTGCC‐3′) and 3′ (5′‐GACCTGCAGGCATGCAAGCTCGGC‐3′) ends of glpD of strain JG3 using degenerate colony and arbitrary PCR methods, respectively. The developed degenerate colony PCR resulted amplification of targeted 421‐bp DNA, while the set arbitrary PCR resulted in non‐targeted 436‐bp DNA. Deduced amino acid analysis showed that both sequences shared 94% amino acid similarity with molybdenum cofactor biosynthesis (MoaC) of Pseudomonas stutzeri and benzoate membrane transporter (BenE) of A. faecalis, respectively. Practical applications It is suggested that pterin‐based Molybdenum cofactor (Moco) biosynthesis involving moa gene is related with the pathogenesis of several Gram‐negative bacteria, while in addition to lipase genes, glycerol coding genes including glpD are involved in effective degradation of fat waste. However, information about these genes in pathogenic, food‐borne, Gram‐negative Alcaligenes sp. JG3 bacterium originated from root of Zea mays is barely found. A pair of degenerate primers (GMF: 5′‐ATCGGCATCACCAACCAGC‐3′ and GMR: 5′‐TGTCGATGGTGCCGAAGC‐3′) designed in this study could detect 421‐bp moaC gene fragment using degenerate colony PCR, while another pair of gene specific primers 5′ (5′‐TGATGAATGTTCCGTTGCGCTGCC‐3′) and 3′ (5′‐GACCTGCAGGCATGCAAGCTCGGC‐3′) aiming to amplify ends of glpD of Alcaligenes sp. JG3 detected a nontargeted, 436‐bp benE gene of the strain using an arbitrary PCR method.

Overexpression of Lipase Gene from <i>Alcaligenes</i> sp. JG3 and its Activity toward Hydrolysis Reaction

“…Alcaligenes sp. JG3 bacterium samples were a collection of Laboratorium Penelitian dan Pengujian Terpadu UGM, originally isolated from the root of Zea mays in the agricultural land of Purwokerto, Central Java, Indonesia [18]. Primer forward Fjg3 (5ʼ-ATGACCGAGC TGACTGTAG-3ʼ), Fexp (5'-GGATCCACCGAGCTGA CTGTAGAC-3') and reverse Rjg3 (5ʼ-TCAGGAGGGGT AAATCCAC-3ʼ), Rexp (5'-AAGCTTGGAGGGGTAAA TCCACAG-3'), agarose, proteinase-K, ethidium bromide, DNA marker, nuclease-free water, Quick Miniprep Plasmid Kit (Invitrogen), QIAexpresionist Kit Type IV (Qiagen), BamHI and HindIII restriction kit (Promega), MgCl2, NaCl, Sodium dodecyl sulfate (SDS), isopropanol, ethanol, tris base (Merck), Triton X-100, Na-EDTA (Sigma), TAE buffer, loading buffer (Vivantis), extra virgin olive oil (Bertolli), Pierce BCA protein assay kit and pre-stained protein marker (Thermo Fisher Scientific), Go taq green PCR mix, SOC medium, LB medium, nutrient agar, nutrient broth (NB), n-hexane, acetic acid, ammonium persulfate, tetramethylethylenediamine (TEMED), Coomassie blue, acrylamide, bis-acrylamide, glycine, phenolphthalein, and also antibiotic ampicillin and kanamycin.…”

“…The presence of Mg 2+ enhances the binding ability of phosphate residue on ATP. While the residues of Y 13 , N 16 , V 18 , S 38 , G 39 , S 40 , G 41 , K 42 , T 43 , T 44 , and Q 88 are predicted to be the binding site for Ca 2+ and the activity of crude extract lipase from Alcaligenes sp. JG3 is enhanced by 1.38 times with the addition of Ca 2+ [11].…”

Evaluation of antioxidant and antimicrobial activity of phenolic lipids produced by the transesterification of 4-hydroxyphenylacetic acid and triglycerides

“…B. coagulans is frequently found in acidified food with pH values ranging 4-4.5, causing flat sour spoilage [25]. A. faecalis is a food-borne opportunist, and contaminates medical devices, leading to infection in blood [26][27][28]. G. stearothermophilus causes spoilage in processed food, such as canned foods and evaporated milk [29][30][31].…”

GENOTYPIC AND PHENOTYPIC CHARACTERIZATION OF Alcaligenes javaensis JG3 POTENTIAL AS AN EFFECTIVE BIODEGRADER

“…Amplification by colony PCR using the designed primers aiming to amplify the glpK partial region (GKF and GKR) was performed in a 25 μL reaction volume at annealing temperature of 50 °C with other PCR parameters set as previously described (Ethica et al 2013b(Ethica et al , 2017. The isolated DNA from this process was purified, followed by sequencing.…”