This study aims to determine the factors that can affect financial distress in food and beverage companies listed on the Indonesia Stock Exchange in 2014-2018. The factors used are the size of the hood and financial distress.This type of research is an associative causal research with an ex post facto approach. Samples were taken using purposive sampling technique. A sample of 34 companies from 168 food and beverage companies listed on the Indonesia Stock Exchange in 2014-2018, so that the analyzed research data amounted to 170. The data analysis techniques used were descriptive statistics and logistic regression.The results of this study indicate that (1) Profit has no significant effect on predicting financial distress conditions. (2) Cash flow has no effect in predicting financial distress conditions. (3) Leverage has no effect in predicting financial distress conditions. And simultaneously this study states that earnings, cash flow and leverage do not affect predicting financial distress.

No abstract

ART reduces the prevalence of OPC, and the total fungal and C. albicans burden. Levels of salivary β-defensin-2 may associate with OPC in HIV patients responding to ART.

No abstract

Coinfection with human immunodeficiency virus (HIV) and hepatitis C virus (HCV) is common in Asia, but the effects of antiretroviral therapy (ART) are unclear. Histopathological changes in the liver are described in a prospective study of HCV-seropositive HIV-infected patients at Cipto Mangunkusomo Hospital (Jakarta, Indonesia). Liver biopsy specimens were collected at baseline (n = 48) and 48 weeks (n = 34). Ishak scores showed mild but detectable inflammation and/or fibrosis. Levels of portal inflammation declined during ART (P = .03), whereas fibrosis remained (P = .11). Portal infiltration of CD4(+) cells increased during ART (P < .0001), whereas infiltration of CD8(+) cells subsided. Numbers of CD4(+) cells in the liver at baseline correlated with circulating CD4(+) T-cell counts (P = .03-.05). Numbers of liver-infiltrating CD4(+) and CD8(+) cells at baseline were not associates with subsequent experience of an immune restoration disease, which is defined by a rise in alanine transaminase levels during ART.

Bacillus thuringiensis is one type of bacteria that has been used as a microbiological control agent for pests and a vector of plant disease. The presence of Cry proteins inside the B. thuringiensis can be acted as a specific insect repellent that only toxic to certain insects. The CryI protein is toxic to Lepidoptera insects which can attack various types of plants. Polymerase Chain Reaction (PCR) is a common method that can be used to amplify the gene encoding CryI proteins from B. thuringiensis. This research aimed to design a good primer candidate for cryI gene amplification from B. thuringiensis. In silico analysis for designing cryI primer was carried out using some software, such as BLAST for searching cryI gene sequence, Bioedit for sequences alignment, and DINAmelt for analyzing dimer structure of primers. Ten primer candidates were successfully obtained based on the result of the primer3 software. A pair of primer was selected to amplify the cryI gene, with forward primer 5’- CGGTGAATGCCCTGTTTACT -3’ and reverse primer 5’-CGGTCTGGTTGCCTATTGAT -3’. Amplification of the cryI gene by PCR method using selected primer resulting in a PCR product with a length of approximately 200 bp.

Objectives: Ultraviolet (UV)-mediated photoreaction and photo-oxidation damage the skin, which can be prevented by using sunscreens as photo protective agents. Mangiferin is a major constituent of Phaleria macrocarpa fruits that has both sunscreen and antioxidant activity. This study aimed to formulate and evaluate sunscreen gel made from mangiferin isolated from P. marcocarpha fruits. Methods: Sunscreen gels were formulated using three different concentrations of mangiferin (1.25%, 2.5%, and 5%) and their physicochemical parameters (color, odor, homogeneity, spread ability, pH, and accelerated stability) were tested. The in vitro Sun Protection Factor (SPF) of the gels was determined using UV spectrophotometry. Sensory evaluation (hedonic test) was performed with a panel of 32 untrained panelists. Skin irritation test was conducted on 20 female volunteers using a skin patch. Results: The three mangiferin sunscreen gels showed high absorbance at wavelengths of 290-360 nm. The SPF was 11.2, 38.6, and and 88.53 at a mangiferin concentration of 1.25%, 2.5%, and 5%, respectively. The gels' pH was in the proper range (5.8-6.0), and they showed good spread ability, no phase separation, and acceptable consistency. They were found to be stable during a two-month stability study. A gel containing 2.5% concentration of mangiferin is the most preferred formula. In addition, they did not irritate the skin. Conclusion: Gels formulation containing mangiferin at concentrations of 1.25, 2.5, and 5% are effective as sunscreens. The gel meets the requirements on physicochemical parameters and is stable for two months storages at temperatures 8°C, 25°C and 40°C.

No abstract