Bacillus thuringiensis is one type of bacteria that has been used as a microbiological control agent for pests and a vector of plant disease. The presence of Cry proteins inside the B. thuringiensis can be acted as a specific insect repellent that only toxic to certain insects. The CryI protein is toxic to Lepidoptera insects which can attack various types of plants. Polymerase Chain Reaction (PCR) is a common method that can be used to amplify the gene encoding CryI proteins from B. thuringiensis. This research aimed to design a good primer candidate for cryI gene amplification from B. thuringiensis. In silico analysis for designing cryI primer was carried out using some software, such as BLAST for searching cryI gene sequence, Bioedit for sequences alignment, and DINAmelt for analyzing dimer structure of primers. Ten primer candidates were successfully obtained based on the result of the primer3 software. A pair of primer was selected to amplify the cryI gene, with forward primer 5’- CGGTGAATGCCCTGTTTACT -3’ and reverse primer 5’-CGGTCTGGTTGCCTATTGAT -3’. Amplification of the cryI gene by PCR method using selected primer resulting in a PCR product with a length of approximately 200 bp.
The ability to regenerate tissue is different for each organism. Mice (Mus musculus) able to regenerate the 3rd phalange of a digit. The tissue regeneration process has four phases are the wound-healing phase, the blastema phase, the regeneration phase, and the maturation phase. Each phase has a different process and different activity of cells. Histological analysis is very important to see the activity of each cell in each phase of tissue regeneration. Through histological analysis we can find out the role of each cell in the tissue regeneration process as well as the processes that occur in tissue regeneration. In this study, we analyzed tissue histology in the digit tip mice at each regeneration phase post amputated. The phalanges were amputated on the 3rd phalanges of digit tip of 24 male mice which had been previously sedated using ketamine / xylazine. Digit tip were allowed to grow and regenerate, and samples were taken on days 0, 1, 3, 5, 10, 15, 25 after amputation. Histological analysis was performed using Hematoxylin-eosin staining on a sample preparation that had been made into paraffin blocks first. The histological showed that at the beginning of the wound, the tissue rapidly forms a thin epidermal layer to cover the wound. In the wound healing phase, some of embryonal cells proliferated and migrated actively. In the blastema phase, granule cells cluster to form various new tissues. In the regeneration phase, new tissue begins to form, such as blood vessel, muscle, bone, and epidermal tissue. In the regeneration phase on day 15, several new tissues have begun to form, such as blood vessel tissue, muscle, hemorrhoid, bone and epidermis. Finally, in the maturation phase on day 25, the tissue morphology process occurs and perfecting the digit tip mice tissue.
Bacillus thuringiensis is one species of bacteria that has been applied as a microbiological control agent for pests and a vector of plant disease. The availability of Cry proteins in B. thuringiensis can be acted as a specific insect exterminator that only toxic to certain insects. The cryII gene is an example of a type of cry gene that encodes a CryII Protein. The CryII protein is toxic to Lepidoptera insects which can attack Helicoverpa armigera species which is a corn borer. Polymerase Chain Reaction (PCR) is a general method that can be used to amplify the gene. This research purposed to design a good primer candidate for cryII gene amplification from B. thuringiensis. In silico analysis for designing cryII primer was carried out using some software, such as BLAST for searching cryII gene sequence, Bioedit for sequences alignment, and DINAmelt for analyzing dimer structure of primers. Ten primer candidates were successfully obtained based on the result of the primer 3 software. A pair of primer was selected to amplify the cryII gene, with forward primer 5’-GGTAGTGGACCACAGCAGAC-3’and reverse primer 5’-TCTTCTGGCGCCAAATGGAT-3’. This primer has fulfilled good primer characteristics because it does not cause dimer structure and the resulting amplicons do not form secondary structures. Amplification of the cryI gene by PCR method using selected primer resulting in a PCR product with a length of approximately 800 bp.
Antibacterial is a compound capable of inhibiting and killing pathogenic bacteria. Escherichia coli and Staphylococcus aureus are pathogenic bacteria because they can cause disease if infected. Sweet potato is an alternative food that is often consumed by some Indonesian people and is thought to contain antibacterial compounds. The sweet potatoes used in this study came from Riau (A), Tomohon (B), Balikpapan (C), Jambi (D), Malang (E), Pontianak (F), Kupang (G), Bangka Belitung (H) , Medan (I), Balikpapan (J), and Merauke (K). Antibacterial testing was carried out using the disc diffusion method and using Eosin Methylene Blue (EMB) and Luria Bertani (LB) media with sample concentrations of 250, 500, and 700 ppm. The study was conducted using the antimicrobial activity testing method which was carried out only once in an experiment and observations would be made after 24 hours of incubation. From the results obtained, the optimum growth of E. Coli at a concentration of 700 ppm with samples from the Kupang area (G) with purple color with an inhibition zone of 8.5 mm and a minimum at a concentration of 250 ppm with samples originating from the Merauke (K) area with white color with a white zone. resistance of 1 mm. Meanwhile, the test results on the optimum growth of S. aureus at a concentration of 700 ppm with samples from West Kalimantan (F2) with purple color with an inhibition zone of 7 mm and a minimum at a concentration of 250 ppm with samples from Balikpapan (C), Bangka Belitung. (H), and Medan (I3) are white and light orange with an inhibition zone of 2 mm.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.