Leptospirosis is a neglected zoonosis with worldwide distribution. The causative agents are spirochete bacteria of the Leptospira genus, displaying huge diversity of serovars, the identity of which is critical for effective diagnosis and vaccination purposes. Among many other mammalian species, Leptospira infects cattle, eliciting acute signs in calves, and chronic disease in adult animals often leading to abortions. In South America, and including in Uruguay, beef and dairy export are leading sources of national income. Despite the importance of bovine health, food safety, and bovine-related dissemination of leptospirosis to humans, extremely limited information is available as to the identity of Leptospira species and serovars infecting cattle in Uruguay and the South American subcontinent. Here we report a multicentric 3-year study resulting in the isolation and detailed characterization of 40 strains of Leptospira spp. obtained from infected cattle. Combined serologic and molecular typing identified these isolates as L. interrogans serogroup Pomona serovar Kennewicki (20 strains), L. interrogans serogroup Canicola serovar Canicola (1 strain), L. borgpetersenii serogroup Sejroe serovar Hardjo (10 strains) and L. noguchii (9 strains). The latter showed remarkable phenotypic and genetic variability, belonging to 6 distinct serogroups, including 3 that did not react with a large panel of reference serogrouping antisera. Approximately 20% of cattle sampled in the field were found to be shedding pathogenic Leptospira in their urine, uncovering a threat for public health that is being largely neglected. The two L. interrogans serovars that we isolated from cattle displayed identical genetic signatures to those of human isolates that had previously been obtained from leptospirosis patients. This report of local Leptospira strains shall improve diagnostic tools and the understanding of leptospirosis epidemiology in South America. These strains could also be used as new components within bacterin vaccines to protect against the pathogenic Leptospira strains that are actually circulating, a direct measure to reduce the risk of human leptospirosis.
We studied microorganisms associated with infant diarrhea in a group of 256 children admitted to a public pediatric hospital in Montevideo, Uruguay. Diagnostic procedures were updated to optimize detection of potential pathogens, which were found in 63.8% of cases, and to be able to define their characteristics down to molecular or antigenic type. Coinfection with two or more agents was detected in more than one-third of positive studies. Escherichia coli enteric virotypes, especially enteropathogenic E. coli (EPEC), were shown to be prevalent. Rotavirus, Cryptosporidium, Campylobacter (mainly Campylobacter jejuni), and Shigella flexneri were also often identified. Enterotoxigenic E. coli, Salmonella, and Giardia lamblia were sporadically recognized. Unusual findings included two enteroinvasive E. coli strains, one Shigella dysenteriae 2 isolate, and a non-O:1 Vibrio cholerae culture. EPEC bacteria and S. flexneri (but not Salmonella) showed unusually frequent antimicrobial resistance, especially towards beta-lactam antibiotics, which is the subject of ongoing work.
A total of 71 enteropathogenic Escherichia coli (EPEC) strains isolated from children with diarrhoea in Montevideo, Uruguay, were characterized in this study. PCR showed that 57 isolates carried eae and bfp genes (typical EPEC strains), and 14 possessed only the eae gene (atypical EPEC strains). These EPEC strains belonged to 21 O : H serotypes, including eight novel serotypes not previously reported among human EPEC in other studies. However, 72 % belonged to only four serotypes: O55 : H− (six strains), O111 : H2 (13 strains), O111 : H− (14 strains) and O119 : H6 (18 strains). Nine intimin types, namely, α1 (two O142 strains), β1 (29 strains, including 13 O111 : H2 and 14 O111 : H−), γ1 (three O55 : H− strains), θ (five strains, including three strains with H40 antigen), κ (two strains), ε1 (one strain), λ (one strain), μB (six strains of serotypes O55 : H51 and O55 : H−) and ξR/β2B (22 strains, including 18 O119 : H6) were detected among the 71 EPEC strains. The authors have identified two novel intimin genes (μB and ξR/β2B) in typical EPEC strains of serotypes O55 : H51/H− and O119 : H6/H−. The complete nucleotide sequences of the novel μB and ξR/β2 variant genes were determined. PFGE typing after XbaI DNA digestion was performed on 44 representative EPEC strains. Genomic DNA fingerprinting revealed 44 distinct restriction patterns and the strains were clustered in 12 groups. Only 15 strains clustered in six groups of closely related (similarity >85 %) PFGE patterns, suggesting the prevailing clonal diversity among EPEC strains isolated from children with diarrhoea in Montevideo.
We report the first Shiga toxin 2-producing Acinetobacter haemolyticus strain that was isolated from the feces of a 3-month-old infant with bloody diarrhea. Usual enteropathogenic bacteria were not detected. This finding suggests that any Shiga toxin-producing microorganism capable of colonizing the human gut may have the potential to cause illness. CASE REPORTIn November 2001, a 3-month-old male infant was admitted at Pereira Rossell Pediatric Hospital with bloody diarrhea of 12 h evolution without fever or other previous pathologies. The patient was treated empirically with intravenous ceftriaxone and hospitalized for 24 h.Samples of feces were obtained before and after the patient was treated with antibiotics, and they were simultaneously studied at the Microbiology laboratory of the Pereira Rossell Pediatric Hospital and at the Reference laboratory for Shiga toxin-producing Escherichia coli. This last study, done in the context of an institutional program aimed at the regional surveillance of bloody diarrheas and hemolytic-uremic syndrome (HUS) etiology, is the focus of the present article.The presence of Salmonella, Shigella, enteroinvasive E. coli, and enteropathogenic E. coli, Yersinia enterocolitica, and Campylobacter in fecal samples was studied using standard procedures, as previously described (18). The searching of Shiga toxin-producing E. coli (STEC) was done by selective enrichment protocol (9) on Trypticase soy broth (Bacto, Le Pont de Claix, France) with 2.5 mg/liter sodium tellurite and 0.05 mg/liter cefixime (CT-TSB; BioMérieux, Marcy LЈÉtoile, France) and further isolation on MacConkey sorbitol (SMAC) plates (Oxoid, Hampshire, England).The microscopic analysis of the two fecal samples showed a low number of leukocytes (5 to 10 per microscopic field) and did not reveal spiral bacteria that would suggest the presence of Campylobacter spp.The cultures from the first fecal sample developed well in all inoculated media.From the second fecal sample, only 12 colonies (all sorbitol negative) were recovered on a directly inoculated SMAC plate after 48 h of culture. From the enrichment broth, we did not recover any microorganism on the SMAC plate.The microbiological studies did not reveal the presence of usual enteropathogenic bacteria in any of the two samples.Twenty sorbitol-positive colonies plus a lysate from the confluent zone in the SMAC plate of the first sample (nonfermenting colonies were not recovered) and the 12 sorbitolnegative colonies recovered from the second sample were analyzed by PCR, as previously described (13), to detect the presence of Stx1/Stx2-encoding organisms. This PCR was performed with primers VT1A-F (GAAGAGTCCGTGGGATT ACG) and VT1B-R (AGCGATGCAGCTATTAATAA) for stx 1 and with primers VT2A-F (TTAACCACACCCACGGCAGT) and VT2B-R (GCTCTGGATGCATCTCTGGT) for stx 2 .E. coli K-12 C600 E. coli K-12 C600 (F Ϫ thi-1 thr-1 leuB6 lacY1 tonA21 supE44 ⌬ ⌬stx 1 ⌬stx 2 ) and Stx2/Stx1-producing E. coli STEC O157:H7 EDL933 were used as negative and positive controls, respectively, in all PCR as...
The aim of this work was to study the prevalence of Listeria monocytogenes in foods obtained in retail shops and food industries located in Montevideo-Uruguay, and to identify the serogroups of the obtained isolates. Three-thousand one-hundred and seventy-five food samples (frozen, deli meats, ready-to-eat and cheese) were analyzed. The obtained isolates were serogrouped by multiplex PCR and serotyped by conventional procedure. Genetic comparisons were performed using pulsed-field gel electrophoresis on a sub-set of isolates belonging to the same serotype successively recovered from the same establishment. L. monocytogenes was isolated from 11.2% of samples. The highest prevalence was observed in frozen foods (38%), followed by cheese (10%). 1/2b and 4b were the most frequently identified serotypes. In six of 236 analyzed establishments we successively recovered L. monocytogenes isolates belonging to the same serotype. Most of them corresponded to serotype 1/2b. Pulsed-field gel electrophoresis profiles suggest that at least 33% of L. monocytogenes 1/2b isolates are genetically related and that may remain viable for prolonged periods. The observed prevalence of L. monocytogenes was lower than reported in neighboring countries. Our findings highlight the role that frozen foods may play in the spread of this pathogen, and the relevance of serotypes 1/2b and 4b.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.