Migraine is a common disabling disorder with a significant genetic component, characterized by severe headache and often accompanied by nausea, vomiting, and light sensitivity. We identified two families, each with a distinct missense mutation in the gene encoding casein kinase Iδ (CKIδ), in which the mutation cosegregated with both the presence of migraine and advanced sleep phase. The resulting alterations (T44A and H46R) occurred in the conserved catalytic domain of CKIδ, where they caused reduced enzyme activity. Mice engineered to carry the CKIδ-T44A allele were more sensitive to pain after treatment with the migraine trigger nitroglycerin. CKIδ-T44A mice also exhibited a reduced threshold for cortical spreading depression (believed to be the physiological analog of migraine aura) and greater arterial dilation during cortical spreading depression. Astrocytes from CKIδ-T44A mice showed increased spontaneous and evoked calcium signaling. These genetic, cellular, physiological, and behavioral analyses suggest that decreases in CKIδ activity can contribute to the pathogenesis of migraine.

Ion channels have emerged as regulators of developmental processes. In model organisms and in people with mutations in ion channels, disruption of ion channel function can affect cell proliferation, cell migration, and craniofacial and limb patterning. Alterations of ion channel function affect morphogenesis in fish, frogs, mammals, and flies, demonstrating that ion channels have conserved roles in developmental processes. One model suggests that ion channels affect proliferation and migration through changes in cell volume. However, ion channels have not explicitly been placed in canonical developmental signaling cascades until recently. This review gives examples of ion channels that influence developmental processes, offers a potential underlying molecular mechanism involving bone morphogenetic protein (BMP) signaling, and finally explores exciting possibilities for manipulating ion channels to influence cell fate for regenerative medicine and to impact disease.

SUMMARYMutations that disrupt function of the human inwardly rectifying potassium channel KIR2.1 are associated with the craniofacial and digital defects of Andersen-Tawil Syndrome, but the contribution of Kir channels to development is undefined. Deletion of mouse Kir2.1 also causes cleft palate and digital defects. These defects are strikingly similar to phenotypes that result from disrupted TGF/BMP signaling. We use Drosophila melanogaster to show that a Kir2.1 homolog, Irk2, affects development by disrupting BMP signaling. Phenotypes of irk2 deficient lines, a mutant irk2 allele, irk2 siRNA and expression of a dominant-negative Irk2 subunit (Irk2DN) all demonstrate that Irk2 function is necessary for development of the adult wing. Compromised Irk2 function causes wingpatterning defects similar to those found when signaling through a Drosophila BMP homolog, Decapentaplegic (Dpp), is disrupted. To determine whether Irk2 plays a role in the Dpp pathway, we generated flies in which both Irk2 and Dpp functions are reduced. Irk2DN phenotypes are enhanced by decreased Dpp signaling. In wild-type flies, Dpp signaling can be detected in stripes along the anterior/posterior boundary of the larval imaginal wing disc. Reducing function of Irk2 with siRNA, an irk2 deletion, or expression of Irk2DN reduces the Dpp signal in the wing disc. As Irk channels contribute to Dpp signaling in flies, a similar role for Kir2.1 in BMP signaling may explain the morphological defects of Andersen-Tawil Syndrome and the Kir2.1 knockout mouse. DEVELOPMENT MATERIALS AND METHODS Maintenance of Drosophila stocksStocks were maintained on cornmeal food at 25°C or 18°C in a Percival incubator model 122 vL (Percival Scientific). Generation of the UAS-Irk2DN and UAS-Irk2WT fly strainsirk2A from Berlin w1118 fly cDNA was cloned into the EcoRI and XhoI sites of the pUAST vector. PCR was performed with cDNA template and primers (GGAATTCCATGCGTTTCAATTTCTCC and CCGCTCGAGCGGCTA -GGA GGCCTGGTCAGA) to add EcoRI and XhoI sites. Sequencing ensured fidelity of the construct. UAS-Irk2 DN was constructed by cutting irk2A out of UAS-irk2 WT with EcoRI and XhoI, and ligating into pET. The GYG of pET-Irk2A template plasmid was mutated to AAA using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) with the following primers: ACGCAGCACACTATTGCCGCTGCCGTCC-GAACCACCTCG and CGAGGTGGTTCGGACGGCAGCGGCAATA -GTGTGCTGCGT. Irk2-DN was removed from the pET vector with EcoRI and XhoI restriction enzymes and ligated into pUAST. All constructs were sequenced to verify the GYG to AAA mutations. We injected UAS-Irk2 WT or UAS-Irk2 DN plasmid with transposase DNA into 1-hour-old Berlin w1118 embryos. Matured injected flies were crossed to Berlin w1118 and progeny with the transgene were selected by eye color. irk1-AAA and irk3-AAA were generated with the same strategy using primer pairs: ACCCAGACGAC-GATAGCCGCTGCCAATC/CGTCACATAGCGATTGGCAGCGGCTA T -C (Irk1-AAA) and ATCGAGTCCAAGATACGAGTCTACATCATC/GAT-GATGTAGACTCGTATCTTGGACTCGATGGA (Irk3-AAA). Drosophila strainsT...

Vaccines derived from chimpanzee adenovirus Y25 (ChAdOx1), human adenovirus type 26 (HAdV-D26), and human adenovirus type 5 (HAdV-C5) are critical in combatting the severe acute respiratory coronavirus 2 (SARS-CoV-2) pandemic. As part of the largest vaccination campaign in history, ultrarare side effects not seen in phase 3 trials, including thrombosis with thrombocytopenia syndrome (TTS), a rare condition resembling heparin-induced thrombocytopenia (HIT), have been observed. This study demonstrates that all three adenoviruses deployed as vaccination vectors versus SARS-CoV-2 bind to platelet factor 4 (PF4), a protein implicated in the pathogenesis of HIT. We have determined the structure of the ChAdOx1 viral vector and used it in state-of-the-art computational simulations to demonstrate an electrostatic interaction mechanism with PF4, which was confirmed experimentally by surface plasmon resonance. These data confirm that PF4 is capable of forming stable complexes with clinically relevant adenoviruses, an important step in unraveling the mechanisms underlying TTS.

No abstract

BackgroundThe prolonged time course of Huntington's disease (HD) neurodegeneration increases both the time and cost of testing potential therapeutic compounds in mammalian models. An alternative is to initially assess the efficacy of compounds in invertebrate models, reducing time of testing from months to days.Methodology/Principal FindingsWe screened candidate therapeutic compounds that were identified previously in cell culture/animal studies in a C. elegans HD model and found that two FDA approved drugs, lithium chloride and mithramycin, independently and in combination suppressed HD neurotoxicity. Aging is a critical contributor to late onset neurodegenerative diseases. Using a genetic strategy and a novel assay, we demonstrate that lithium chloride and mithramycin remain neuroprotective independent of activity of the forkhead transcription factor DAF-16, which mediates the effects of the insulin-like signaling pathway on aging.Conclusions/SignificanceThese results suggest that pathways involved in polyglutamine-induced degeneration are distinct from specific aging pathways. The assays presented here will be useful for rapid and inexpensive testing of other potential HD drugs and elucidating pathways of drug action. Additionally, the neuroprotection conferred by lithium chloride and mithramycin suggests that these drugs may be useful for polyglutamine disease therapy.

Huntington's disease is a progressive neurodegenerative disease caused by a polyglutamine (polyQ) repeat expansion in the huntingtin protein [Huntington's Disease Collaborative Research Group (1993) Cell 72, 971-983]. To understand the mechanism by which polyQ repeats cause neurodegeneration and cell death, we modeled polyQ neurotoxicity in Caenorhabditis elegans. In our model, expression of N-terminal fragments of human huntingtin causes polyQdependent degeneration of neurons. We conducted a genetic screen to identify proteins that protect neurons from the toxic effects of expanded polyQ tracts. Loss of polyQ enhancer-1 (pqe-1) gene function strongly and specifically exacerbates neurodegeneration and cell death, whereas overexpression of a pqe-1 cDNA protects C. elegans neurons from the toxic effects of expanded huntingtin fragments. A glutamine͞proline-rich domain, along with a charged domain, is critical for PQE-1 protein function. Analysis of pqe-1 suggests that proteins exist that specifically protect neurons from the toxic effects of expanded polyQ disease proteins. A t least eight hereditary neurodegenerative disorders, includingHuntington's disease (HD), have been identified in which the disease locus encodes a protein containing an expanded glutamine tract (1). HD patients carry expanded glutamine repeats in the N terminus of huntingtin, a widely expressed protein of unknown function (2, 3). Although huntingtin is expressed in many cell types, the primary cellular pathology of HD is degeneration of neurons of the striatum and cortex, leading to dramatic personality changes and motor dysfunction in early stages of the disease (4, 5). Generally, the onset of disease symptoms is inversely related to the length of the glutamine expansion. However, additional factors distinct from polyglutamine (polyQ) length influence the age of onset. For example, genotypic variation linked to a region encoding the GluR6 kainate receptor accounts for Ϸ10% of the variance in the age of onset (6, 7).Molecular aspects of HD provide clues toward understanding the mechanism by which mutant huntingtin causes neurotoxicity. Expanded glutamine tracts in the huntingtin protein alter its physical properties (8, 9). PolyQ-containing N-terminal fragments of mutant huntingtin form cytosolic and nuclear aggregates in affected tissue (10). Therefore, the expanded glutamine tract in mutant huntingtin may elicit neurotoxicity by altering interactions of huntingtin with critical cellular constituents. For example, in the yeast two-hybrid system, normal huntingtin associates with Hip1, a human homolog of the yeast cytoskeletal protein, Sla2 (11-13). Loss of a normal interaction between Hip1 and mutant huntingtin may disrupt cytoskeletal integrity, leading to degeneration. Furthermore, transcription factors are sequestered by mutant huntingtin, interfering with normal gene transcription (14-16). Thus, the mechanisms of pathogenesis of HD may be triggered by changes or alterations of interactions with normal or abnormal protein partners.The mo...

Mutations in the microtubule cytoskeleton are linked to cognitive and locomotor defects during development, and neurodegeneration in adults. How these mutations impact microtubules, and how this alters function at the level of neurons is an important area of investigation. Using a forward genetic screen in mice, we identified a missense mutation in Tuba1a α-tubulin that disrupts cortical and motor neuron development. Homozygous mutant mice exhibit cortical dysgenesis reminiscent of human tubulinopathies. Motor neurons fail to innervate target muscles in the limbs and show synapse defects at proximal targets. To directly examine effects on tubulin function, we created analogous mutations in the α-tubulin isotypes in budding yeast. These mutations sensitize yeast cells to microtubule stresses including depolymerizing drugs and low temperatures. Furthermore, we find that mutant α-tubulin is depleted from the cell lysate and from microtubules, thereby altering ratios of α-tubulin isotypes. Tubulin-binding cofactors suppress the effects of the mutation, indicating an important role for these cofactors in regulating the quality of the α-tubulin pool. Together, our results give new insights into the functions of Tuba1a, mechanisms for regulating tubulin proteostasis, and how compromising these may lead to neural defects.