Chloroquine was one of the most cheapest and effective chemotherapeutic drugs for Plasmodium falciparum-malaria, but for a long, the drug has been officially withdrawn in almost all malariaendemic countries including Nigeria, due to the development of resistance by the parasite. Withdrawal of the drug may make the drug regains its efficacy. Therefore, this study aimed to determine the presence of Biomarkers associated with chloroquine resistance from Gombe Local Government Area, Gombe State, Nigeria after its withdrawal in 2005. Twenty hundred blood samples were collected from consented study subjects and analysed using Microscopy, RDT and PCR. DNA was extracted using Quick-DNA™ Miniprep (No. D4069), Purity and Concentration of the DNA were determined using Nanodrop Spectrophotometer. 57 true positive samples were selected for molecular analysis. Nested PCR was used to amplify the required codon (C72S, M74I, K76T and N75E) position of PCRT the gene of P. falciparum. Both Primary and Secondary PCR was carried out. The PCR products were subjected to electrophoresis in 2% agarose and stained with ethidium bromide. The amplicons were purified and sequenced, after which the sequenced products were subjected to BLAST software. Single Nucleotide Polymorphism was recorded from C72S and K76T with a prevalence of 05(8.80%) and 46(80.70%) respectively. Confirmed biomarkers of Chloroquine resistance are still present in P. falciparum isolate from Gombe L.G.A.
Human beings are sometime expose to the same to predisposing factors of a given infectious disease, but the outcome in terms of disease manifestation differs greatly. This variation is mainly attributed to the genetic makeup of such individuals; this is because human genetic has long been associated with the variation in susceptibility to various infectious diseases, which is termed as genetic resistance. Therefore the aim of this paper was to review the state of knowledge on genetic resistance associated with malaria infection. Genetic resistance to malaria can be describe as an inherited alteration or changes in the genetic material of humans specifically DNA molecule and other vital biomolecules which increases the chances of resistance to malaria and thus, result in an increased survival of individuals with those genetic alterations. In addition such changes also affect the general wellbeing and survival of the parasite to the extent that the parasite cannot even multiply or replicate itself while in such infected erythrocyte. This is because such alteration in the DNA molecule interferes with some of the vital chemical and biochemical processes of the parasite (Plasmodim spp). Therefore, several genetic disorders and or trait which include: Sickle cell disease, Glocose-6-Phosphatedehyrogenase deficiency, Pyruvate Kinase deficiency, Duffy antigen, Ovalocytocytosis, Thalassemia and ABO blood group are known to offer special protection against malaria disease in individuals who possessed at least one of such disorders or trait.
Introduction Antibiotic resistance is a public health concern in Nigeria and the world, and healthcare workers contributed to the upsurge of antibiotic resistance in hospital settings. This study focused on the knowledge, attitude, and practice (KAP) of antibiotic use and the frequency of prescriptions of antibiotics from the list of WHO Model Essentials Antibiotics (AWaRe) (in the last 6 months) among healthcare workers and established the determining factors in six hospitals in Niger state, Nigeria. Methodology A KAP survey was conducted in Niger State, Nigeria, from March to June 2022. A structured self-administered, pretested questionnaire was distributed to six hospitals in the state following a stratified random sampling considering the staff capacity, the population of the city, and patients’ patronage. Results A total of 350 questionnaires distributed, and 313 (89.4%) completed and returned from the six hospitals. The median scores were knowledge (75%), attitude (69%), practice (62%), and self-reported prescription (70%), and respondents with good scores were knowledge [195 (62.3%)], attitude [185 (59.1%)], practice [201 (64.2%)], and prescription [117 (37.4%)]. In multivariate analysis, older respondents are more likely to have a good prescription ( p = 0.006), and prior antimicrobial training improved their knowledge ( p < 0.001), attitude ( p = 0.007), and prescription pattern ( p = 0.009). All the study participants had prescribed one or more of the most prescribed antibiotics; Amoxicillin clavulanate (Access group, 96.5%), Amoxicillin (Access group, 95.9%), and Metronidazole (Access group, 95.7%). Conclusions The study suggests that antibiotic education for healthcare workers and antimicrobial stewardship programs are significant interventions to mitigate antibiotic overuse in the state.
Malaria is a life-threatening parasitic disease which causes enormous morbidity and mortality in tropical African countries. Successful prevention and treatment of infected individuals heavenly depend on successful diagnosis using recommended techniques. These routine laboratory techniques have different performance indices. Therefore, this study aimed to evaluate the performance of Polymerase Chain Reaction and Microscopy in malaria diagnosis. A total of two hundred consented study subjects were randomly selected and enrolled for the research. Vein puncture technique was use to collect venus blood from the subjects and analysed using microscopy and Polymerase chain Reaction. DNA samples were extracted using Quick-DNA™ Miniprep Plus Kit with catalogue No. D4069. 18SrRNA gene of Plasmodium falciparum from chromosome 13 was amplified using the primers F5'AACAGACGGGTAGTCATGATTGAG3' R5'GTATCTGATCGTCTTCACTCCC3'. Malaria prevalence of 167(83.50%) and 105(52.5%) were recorded using microscopy and Polymerase Chain Reaction. Microscopy had a sensitivity, specificity, Positive predictive value and negative predictive value of 84.91, 23.40, 55.53 and 57.89%, respectively, with an overall accuracy value of 0.81. Polymerase Chain Reaction had a sensitivity value of 53.89%, specificity of 54.54%, positive predictive value of 85.79% and Negative predictive value of 18.94% with an overall accuracy of 0.54. Microscopy and Polymerase Chain Reaction demonstrated significant accuracy and relatively good performance indices. Therefore Microscopy and Polymerase Chain Reaction are highly recommended as malaria diagnostic techniques, and further research should be carried out to determine the influence of some biological factors of both the parasite and the host on the outcome of the diagnosis using both Polymerase Chain Reaction and microscopy.
Successful malaria diagnosis is the mainstay of successful treatment, prevention and eradication of malaria infection. Apart from the gold standard technique (Microscopy), numerous diagnostic techniques perform a similar function to microscopy and in most cases tend to have varying sensitivity and specificity, especially when compared with the gold standard technique. Therefore this study aimed to determine the Performance and accuracy of SD Bioline Malaria Ag P.f (05fk50) (Rapid Diagnostic Test kit) to Gold standard (Microscopy). A total of two hundred (200) samples were collected from the consented study subjects and analyzed using RDT and Giemsa staining technique. The result revealed an overall prevalence of 132(66.0%) and 167(83.5%) respectively by RDT and Microscopy, where 115 (57.5%) were true positive, there was no significant difference between the two techniques (P> 0.05, df= 1, χ 2 = 3.695). The RDT recorded a sensitivity and specificity value of 68.86% and 48.48% respectively with a positive predictive value of 87.78% and a negative predictive value of 23.53%. The RDT recorded an overall accuracy of 0.66. The Rapid Diagnostic test kit used in the present demonstrated a high level of sensitivity and positive predictive value with relatively low specificity and negative predictive value. Regular checks on the Performance and accuracy of all brands of RDT should be conducted as their performance can be easily affected by some intrinsic and extrinsic factors.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.