Clinical characteristics of women diagnosed with carcinoma who tested positive for cervical and anal high-risk human papillomavirus DNA and E6 RNA

Abstract

High-risk human papillomavirus (hrHPV) is an essential cause of cervical carcinoma and is also strongly related to anal cancer development. The hrHPV E6 oncoprotein plays a major role in carcinogenesis. We aimed to evaluate the frequency of hrHPV DNA and E6 oncoprotein in the anuses of women with cervical carcinoma. We analyzed 117 women with cervical cancer and 103 controls for hrHPV and the E6 oncogene. Positive test results for a cervical carcinoma included 66.7 % with hrHPV-16 and 7.7 % with hrHPV-18. One case tested positive for both HPV variants (0.9 %). The samples from the anal canal were positive for HPV-16 in 59.8 % of the cases. Simultaneous presence of HPV in the cervix and anal canal was found in 53.8 % of the cases. Regarding expression of E6 RNA, positivity for HPV-16 in the anal canal was found in 21.2 % of the cases, positivity for HPV-16 in the cervix was found in 75.0 %, and positivity for HPV-18 in the cervix was found in 1.9 %. E6 expression in both the cervix and anal canal was found in 19.2 % of the cases. In the controls, 1 % tested positive for HPV-16 and 0 % for HPV-18. Anal samples from the controls showed a hrHPV frequency of 4.9 % (only HPV16). The presence of hrHPV in the anal canal of women with cervical cancer was detected at a high frequency. We also detected E6 RNA expression in the anal canal of women with cervical cancer, suggesting that these women are at risk for anal hrHPV infection.

Prevalence of human papillomavirus (HPV) in Brazil: A systematic review and meta-analysis

“…The prevalence of HR-HPV types was 14.07% (95% CI 7.02-26.2). Eleuterio et al [124] and Nicolau et al [156] reported a prevalence of 32% compared to the 14% and 5% reported in three other studies [125,127,128] (Fig 17). This discrepancy might be explained by the HPV genotyping method (56.18% prevalence based on hybrid capture and 14.80% prevalence based on PCR).…”

Characterization of topoisomerase II α and minichromosome maintenance protein 2 expression in anal carcinoma

“…HPV identification followed protocols published previously (19). The main steps are described below.…”

Presence of HPV with overexpression of p16INK4a protein and EBV infection in penile cancer—A series of cases from Brazil Amazon

“…HPV18-E7. qPCR assay included the following primers: forward (5'AAGAAAACGAT GAAATAGATGGA3') and reverse (5'GGCTTCCACCTTACAACACA3') primers, and a probe (5'VIC-AATCATCAACATTTACCAGCC-MGBNFQ3') in a final reaction volume of 25 μL, each qPCR contained 1X TaqMan master mix (Applied Biosystems, Foster City, CA), 400 nM each of the forward and reverse primers, 400 nM fluorogenic TaqMan probe, and 50-100 ng of DNA [24]. The amplification conditions consisted of 50˚C for 2 min and 95˚C for 10 min, followed by 40…”