BackgroundTuberculosis (TB) is one of the most serious health problems in Myanmar. Because TB drug resistance is associated with genetic mutation(s) relevant to responses to each drug, genotypic methods for detecting these mutations have been proposed to overcome the limitations of classic phenotypic drug susceptibility testing (DST). We explored the current estimates of drug-resistant TB and evaluated the usefulness of genotypic DST in Myanmar.MethodsWe determined the drug susceptibility of Mycobacterium tuberculosis isolated from sputum smear-positive patients with newly diagnosed pulmonary TB at two main TB centers in Myanmar during 2013 by using conventional phenotypic DST and the GenoType MTBDRplus assay (Hain Lifescience, Germany). Discrepant results were confirmed by sequencing the genes relevant to each type of resistance (rpoB for rifampicin; katG and inhA for isoniazid).ResultsOf 191 isolates, phenotypic DST showed that 27.7% (n=53) were resistant to at least one first-line drug and 20.9% (n=40) were resistant to two or more, including 18.3% (n=35) multidrug-resistant TB (MDR-TB) strains. Monoresistant strains accounted for 6.8% (n=13) of the samples. Genotypic assay of 189 isolates showed 17.5% (n=33) MDR-TB and 5.3% (n=10) isoniazid-monoresistant strains. Genotypic susceptibility results were 99.5% (n=188) concordant and agreed almost perfectly with phenotypic DST (kappa=0.99; 95% confidence interval 0.96-1.01).ConclusionsThe results highlight the burden of TB drug resistance and prove the usefulness of the genotypic DST in Myanmar.

Psoriasis is a chronic dermatological disorder that has a negative impact on quality of life (QoL). This hospital-based cross-sectional study determined factors associated with health-related QoL (HRQoL) impairment in adult psoriasis patients. HRQoL was assessed using the Dermatology Life Quality Index (DLQI). Disease severity was assessed using the Psoriasis Area and Severity Index (PASI). A total of 223 patients, aged 18 to 83 years, were recruited. For 67 (30%) patients, psoriasis had very large to extremely large effect on their life (DLQI score = 11-30). The median DLQI score was 7 (interquartile range = 7). Factors significantly associated with severe impact on HRQoL (DLQI ≥ 10) were disease severity, single status, working status, sports activities, nail dystrophy, exposed area involvement, itch, disturbed sleep, stress, and infection. The factor predictive of severe impact of psoriasis on HRQoL was disease severity. A holistic approach in the management, including psychosocial issues, is absolutely crucial for the optimal care of psoriasis patients.

HighlightsDrug-resistant tuberculosis (TB) is a major health threat in Myanmar.The first whole-genome sequencing study of drug-resistant TB from Myanmar.Introduction of second-line drug susceptibility testing as part of routine diagnosis in Myanmar is needed.

25The number of multi-drug-resistant tuberculosis (MDR-TB) cases is rising worldwide. As a 26 countermeasure against this situation, the implementation of rapid molecular tests to identify MDR-27 TB would be effective. To develop such tests, information on the frequency and distribution of

Worldwide, studies investigating the relationship between the lineage of Mycobacterium tuberculosis (MTB) across geographic areas has empowered the “End TB” program and understand transmission across national boundaries. Genomic diversity of MTB varies with geographical locations and ethnicity. Genomic diversity can also affect the emergence of drug resistance. In Myanmar, we still have limited genetic information about geographical, ethnicity, and drug resistance linkage to MTB genetic information. This study aimed to describe the geno-spatial distribution of MTB and drug resistance profiles in Myanmar–Thailand border areas. A cross-sectional study was conducted with a total of 109 sequenced isolates. The lineages of MTB and the potential associated socio-demographic, geographic and clinical factors were analyzed using Fisher’s exact tests. p value of statistically significance was set at < 0.05. We found that 67% of the isolates were lineage 1 (L1)/East-African-Indian (EAI) (n = 73), followed by lineage 2 (L2)/Beijing (n = 26), lineage 4 (L4)/European American (n = 6) and lineage 3 (L3)/Delhi/Central Asian (n = 4). “Gender”, “type of TB patient”, “sputum smear grading” and “streptomycin resistance” were significantly different with the lineages of MTB. Sublineages of L1, which had never been reported elsewhere in Myanmar, were detected in this study area. Moreover, both ethnicity and lineage of MTB significantly differed in distribution by patient location. Diversity of the lineage of MTB and detection of new sublineages suggested that this small area had been resided by a heterogeneous population group who actively transmitted the disease. This information on distribution of lineage of MTB can be linked in the future with those on the other side of the border to evaluate cross-border transmission.

No abstract

There were high proportions of XDR-TB and pre-XDR-TB among MDR-TB cases; cross-resistance among second-line drugs was high, with various types of genetic mutations. These data suggest that resistance to second-line anti-tuberculosis drugs should be monitored intensively, and molecular DST should be employed.

T he emergence and spread of multidrug-resistant tuberculosis (MDR-TB) have been a serious threat in the control of TB. This situation has been augmented by the emergence of more-severe extensively drug-resistant tuberculosis (XDR-TB). MDR-TB strains have become resistant to all fluoroquinolones (FQ; specifically, ofloxacin, levofloxacin, moxifloxacin, and gatifloxacin) and all of the second-line injectable drugs (amikacin, capreomycin, and kanamycin). In Myanmar, TB incidence was estimated at 365/100,000 population, and there were 2,793 laboratory-confirmed cases of MDR-TB and rifampin-resistant TB and 11 laboratory-confirmed cases of XDR-TB in 2015 (1). Pyrazinamide (PZA) is a standard component of short-course anti-TB treatment regimens and also of second-line regimens for MDR-TB and XDR-TB (2, 3). PZA is also one component of new regimens: novel rifampin-sparing anti-TB regimens and a shorter MDR-TB treatment regimen (4). There are limited data on PZA resistance because routine drug susceptibility testing (DST) has rarely been performed due to technical difficulties (5, 6). We identified PZA resistance in 66 clinical MDR-TB isolates which were collected at the Yangon and Mandalay TB Centers during 2015 and 2016. Those isolates were used for phenotypic PZA DST by the BACTEC 960 mycobacterial growth indicator tube (MGIT 960) (Becton, Dickinson, Sparks, MD) system at the concentration of 100 g/ml, and the Mycobacterium tuberculosis H37Rv strain was used as the reference strain (7). Mutations in the pncA gene and its promoter region (pncA region) were identified using DNA sequencing to determine genotypic resistance to PZA. The 756-bp pncA gene was sequenced with forward (CGGATTTGTCGCTCACTACA) and reverse (TCCGCCGCCGAACAGTTCATCCCGGT) primers using an ABI 3500XL genetic analyzer (Applied Biosystems, USA). The wild-type pncA gene from M. tuberculosis H37Rv (Gene ID 888260) was used as the reference sequence, and sequences were aligned using Bioedit version 7.2.6.1 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Analysis of the sequences was performed on the basis of sequences in the available literature and online databases (8, 9, 10). Of 66 MDR-TB isolates from Myanmar, 40 (60.6%) were PZA resistant and all of them showed mutations in the pncA region. There was good concordance between phenotypic PZA DST and sequencing results (0.968 kappa coefficient). This finding coincides with those of other studies (6, 11). Forty different types of mutations were distributed in the pncA region, and 10 types were first found in this study. We found 10 FQ-resistant pre-XDR and 7 XDR strains among 40 PZA-resistant isolates (Table 1). A recent multicountry survey reported 3.0 to 42.1% PZA resistance among patients with rifampin resistance (12). Our study showed relatively higher PZA resistance (60.6%) among MDR-TB isolates, and some of them were XDR-and pre-XDR-TB strains. This