VIPERdb (http://viperdb.scripps.edu) is a relational database and a web portal for icosahedral virus capsid structures. Our aim is to provide a comprehensive resource specific to the needs of the virology community, with an emphasis on the description and comparison of derived data from structural and computational analyses of the virus capsids. In the current release, VIPERdb2, we implemented a useful and novel method to represent capsid protein residues in the icosahedral asymmetric unit (IAU) using azimuthal polar orthographic projections, otherwise known as Φ–Ψ (Phi–Psi) diagrams. In conjunction with a new Application Programming Interface (API), these diagrams can be used as a dynamic interface to the database to map residues (categorized as surface, interface and core residues) and identify family wide conserved residues including hotspots at the interfaces. Additionally, we enhanced the interactivity with the database by interfacing with web-based tools. In particular, the applications Jmol and STRAP were implemented to visualize and interact with the virus molecular structures and provide sequence–structure alignment capabilities. Together with extended curation practices that maintain data uniformity, a relational database implementation based on a schema for macromolecular structures and the APIs provided will greatly enhance the ability to do structural bioinformatics analysis of virus capsids.

RNA dependent RNA polymerase (RdRp) is one of the most versatile enzymes of RNA viruses that is indispensable for replicating the genome as well as for carrying out transcription. The core structural features of RdRps are conserved, despite the divergence in their sequences. The structure of RdRp resembles that of a cupped right hand and consists of fingers, palm and thumb subdomains. The catalysis involves the participation of conserved aspartates and divalent metal ions. Complexes of RdRps with substrates, inhibitors and metal ions provide a comprehensive view of their functional mechanism and offer valuable insights regarding the development of antivirals. In this article, we provide an overview of the structural aspects of RdRps and their complexes from the Group III, IV and V viruses and their structure-based phylogeny.

SUMMARY The crystal structure of Seneca Valley Virus-001, SVV-001, the representative member of a new genus “Senecavirus” is reported at 2.3Å resolution. SVV-001 is the first naturally occurring non-pathogenic picornavirus seen to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The non-segmented (+) ssRNA genome of SVV-001 shares closest sequence similarity with the genomes of the members of Cardiovirus. The overall tertiary structure of VP1-VP4 subunits is conserved with the exception of loops, especially those of VP1 that show large deviations relative to the members of the Cardioviruses. The surface loops of VP1 and VP2 are predicted to mediate cell tropism of SVV-001. In addition, the organization of the packaged nucleic acid density indicates that certain regions of VP2 and VP4 interact closely with the packaged nucleic acid.

No abstract

Most subgroup B2 adenoviruses use CD46 as their primary receptor. Recent structural and mutagenesis studies suggested that Ad11 and Ad35 likely engage this receptor in a very similar fashion. However, no comparative studies assessing the cell-associated CD46 binding efficiencies of different Ad fibers have been performed. We solved the crystal structure of Ad35 fiber knob and constructed a model of the fiber knob complexed with CD46. Comparison of our model with that of Ad11-CD46 showed that despite a larger CD46-interacting region in the IJ loop of Ad11, the buried surface area was very similar, suggesting that both fiber knobs might exhibit similar binding. In support of this, cell based competition studies demonstrated almost identical binding efficiencies of Ad11 and Ad35 fibers to cell surface CD46. These findings shed further light on CD46 association by Ad and could impact the selection of novel Ad types for gene transfer.

We report the revised crystal structure of a pseudo-typed human adenovirus at 3.8-Å resolution that is consistent with the atomic models of minor proteins determined by cryo-electron microscopy. The diffraction data from multiple crystals were rescaled and merged to increase the data completeness. The densities for the minor proteins were initially identified in the phase-refined omit maps that were further improved by the phases from docked poly-alanine models to build atomic structures. While the trimeric fiber molecules are disordered due to flexibility and imposition of 5-fold symmetry, the remaining major capsid proteins hexon and penton base are clearly ordered, with the exception of hypervariable region 1 of hexons, the RGD containing loop, and the N-termini of the penton base. The exterior minor protein IX together with the interior minor proteins IIIa and VIII stabilizes the adenovirus virion. A segment of N-terminal pro-peptide of VI is found in the interior cavities of peripentonal hexons, and the rest of VI is disordered. While the triskelion substructures formed by the N-termini of IX conform to excellent quasi 3-fold symmetry, the tetrameric coiled-coils formed by the C-termini and organized in parallel and anti-parallel arrangement do not exhibit any quasi-symmetry. This observation also conveys the pitfalls of using the quasi-equivalence as validation criteria for the structural analysis of extended (non-modular) capsid proteins such as IX. Together, these results remedy certain discrepancies in the previous X-ray model in agreement with the cryo-electron microscopy models.

Seneca Valley Virus-001 (SVV-001) is a newly found species in the Picornaviridae family. SVV-001 is the first naturally occurring nonpathogenic picornavirus observed to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The nonsegmented (+)ssRNA genome of SVV-001 shares closest sequence similarity to the genomes of the members of the Cardiovirus genus. However, based on the distinct characteristics of the genome organization and other biochemical properties, it has been suggested that SVV-001 represents a new genus, namely 'Senecavirus', in the Picornaviridae family. In order to understand the oncolytic properties of SVV-001, the native virus was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group R3, with unit-cell parameters (in the hexagonal setting) a = b = 311.5, c = 1526.4 Å . Although the SVV crystals diffracted to better than 2.3 Å resolution, the data quality is acceptable [I/ (I) > 2.0] to 2.6 Å resolution. The unit-cell volume and the locked rotation-function analysis suggest that six particles could be accommodated in the unit cell, with two distinct sets of one third of a particle, each containing 20 protomers, occupying the crystallographic asymmetric unit.

Banana is the major staple food crop for approximately 400 million people. Bunchy Top disease of Banana is one of the most devastating diseases caused by Banana Bunchy Top Virus (BBTV) that results in a significant loss of yield, stunting and bunchy appearance of leaves. While many isolates of BBTV from various regions of India have been characterized by different groups, no structural study exists for this important virus. To pursue structural studies, the pET28a clone of coat protein (CP) gene from BBTV isolate of Hill Banana grown in lower Pulney Hills (Virupakshi) of Tamilnadu was expressed in BL21 (DE3) pLysS. Purification of the CP was done using Ni-NTA affinity chromatography. In vitro capsid assembly studied using sucrose density gradient centrifugation suggested that the CP did not assemble as virus like particle (VLPs) but remained as smaller oligomers. Studies using dynamic light scattering (DLS) indicates that the purified protein is poly-dispersed represented majorly as pentamers.Studies using both homology modelling and ab initio structure determination gave useful insights into the probable fold of the CP suggesting it is a β-sandwich fold similar to that seen in majority of plant viruses. In silico capsid reconstruction aided understanding of the quaternary organization of subunits in the capsid and molecular interactions present between the subunits. The location of aphid binding EAG motif was identified on the surface loops close to the pentameric axis indicating their role in vector mediated transmission. Introduction X-ray diffraction studies on single crystals of viruses enable visualization of the structures ofintact virus particles at near-atomic resolution. These studies provide detailed information regarding the CP folding, capsid architecture, molecular interactions between protein subunits, and plausible sites of receptor recognition (Prasad & Schmid, 2012;Venkataraman et al., 2008). Such learning is pivotal in designing strategies for combating infections due to viruses in plants, animals and humans. Banana and plantains are grown in about 120 countries in mixed cropping systems by small holders and occasionally in monoculture (INIBAP, 2002). India is Methodology Cloning studiesThe infected leaf samples of BBTV were collected from the farmer's field near NationalResearch Center for Banana and confirmed by direct antigen coating (DAC) ELISA utilizing polyclonal antiserum of BBTV. The total DNA was extracted from the infected leaves through CTAB method (Selvarajan et al., 2008). The 513 bp gene of CP was amplified through PCR using standard CP specific primers (forward 5'-ATG GCTAGGTATCCGAAGAAATCC-3' and reverse 5' TCAAACATGATATGTAATTCTGTTC -3'). The initial denaturation was for 5min at 94°C; followed by 30s denaturation at the same temperature, annealing for 45 secs at 53°C, and extension at 72°C for 30 cycles. The PCR products were analyzed in agarose gel.The CP gene was purified post PCR and was cloned into pET-28a (+) vector between XhoI and NcoI sites and confirmed by sequencing (