Banana is the major staple food crop for approximately 400 million people. Bunchy Top disease of Banana is one of the most devastating diseases caused by Banana Bunchy Top Virus (BBTV) that results in a significant loss of yield, stunting and bunchy appearance of leaves. While many isolates of BBTV from various regions of India have been characterized by different groups, no structural study exists for this important virus. To pursue structural studies, the pET28a clone of coat protein (CP) gene from BBTV isolate of Hill Banana grown in lower Pulney Hills (Virupakshi) of Tamilnadu was expressed in BL21 (DE3) pLysS. Purification of the CP was done using Ni-NTA affinity chromatography. In vitro capsid assembly studied using sucrose density gradient centrifugation suggested that the CP did not assemble as virus like particle (VLPs) but remained as smaller oligomers. Studies using dynamic light scattering (DLS) indicates that the purified protein is poly-dispersed represented majorly as pentamers.Studies using both homology modelling and ab initio structure determination gave useful insights into the probable fold of the CP suggesting it is a β-sandwich fold similar to that seen in majority of plant viruses. In silico capsid reconstruction aided understanding of the quaternary organization of subunits in the capsid and molecular interactions present between the subunits. The location of aphid binding EAG motif was identified on the surface loops close to the pentameric axis indicating their role in vector mediated transmission. Introduction X-ray diffraction studies on single crystals of viruses enable visualization of the structures ofintact virus particles at near-atomic resolution. These studies provide detailed information regarding the CP folding, capsid architecture, molecular interactions between protein subunits, and plausible sites of receptor recognition (Prasad & Schmid, 2012;Venkataraman et al., 2008). Such learning is pivotal in designing strategies for combating infections due to viruses in plants, animals and humans. Banana and plantains are grown in about 120 countries in mixed cropping systems by small holders and occasionally in monoculture (INIBAP, 2002). India is Methodology Cloning studiesThe infected leaf samples of BBTV were collected from the farmer's field near NationalResearch Center for Banana and confirmed by direct antigen coating (DAC) ELISA utilizing polyclonal antiserum of BBTV. The total DNA was extracted from the infected leaves through CTAB method (Selvarajan et al., 2008). The 513 bp gene of CP was amplified through PCR using standard CP specific primers (forward 5'-ATG GCTAGGTATCCGAAGAAATCC-3' and reverse 5' TCAAACATGATATGTAATTCTGTTC -3'). The initial denaturation was for 5min at 94°C; followed by 30s denaturation at the same temperature, annealing for 45 secs at 53°C, and extension at 72°C for 30 cycles. The PCR products were analyzed in agarose gel.The CP gene was purified post PCR and was cloned into pET-28a (+) vector between XhoI and NcoI sites and confirmed by sequencing (
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.