Towards understanding the structure of the capsid of Banana Bunchy Top Virus

Abstract

Banana is the major staple food crop for approximately 400 million people. Bunchy Top disease of Banana is one of the most devastating diseases caused by Banana Bunchy Top Virus (BBTV) that results in a significant loss of yield, stunting and bunchy appearance of leaves. While many isolates of BBTV from various regions of India have been characterized by different groups, no structural study exists for this important virus. To pursue structural studies, the pET28a clone of coat protein (CP) gene from BBTV isolate of Hill Banana grown in lower Pulney Hills (Virupakshi) of Tamilnadu was expressed in BL21 (DE3) pLysS. Purification of the CP was done using Ni-NTA affinity chromatography. In vitro capsid assembly studied using sucrose density gradient centrifugation suggested that the CP did not assemble as virus like particle (VLPs) but remained as smaller oligomers. Studies using dynamic light scattering (DLS) indicates that the purified protein is poly-dispersed represented majorly as pentamers.Studies using both homology modelling and ab initio structure determination gave useful insights into the probable fold of the CP suggesting it is a β-sandwich fold similar to that seen in majority of plant viruses. In silico capsid reconstruction aided understanding of the quaternary organization of subunits in the capsid and molecular interactions present between the subunits. The location of aphid binding EAG motif was identified on the surface loops close to the pentameric axis indicating their role in vector mediated transmission. Introduction X-ray diffraction studies on single crystals of viruses enable visualization of the structures ofintact virus particles at near-atomic resolution. These studies provide detailed information regarding the CP folding, capsid architecture, molecular interactions between protein subunits, and plausible sites of receptor recognition (Prasad & Schmid, 2012;Venkataraman et al., 2008). Such learning is pivotal in designing strategies for combating infections due to viruses in plants, animals and humans. Banana and plantains are grown in about 120 countries in mixed cropping systems by small holders and occasionally in monoculture (INIBAP, 2002). India is Methodology Cloning studiesThe infected leaf samples of BBTV were collected from the farmer's field near NationalResearch Center for Banana and confirmed by direct antigen coating (DAC) ELISA utilizing polyclonal antiserum of BBTV. The total DNA was extracted from the infected leaves through CTAB method (Selvarajan et al., 2008). The 513 bp gene of CP was amplified through PCR using standard CP specific primers (forward 5'-ATG GCTAGGTATCCGAAGAAATCC-3' and reverse 5' TCAAACATGATATGTAATTCTGTTC -3'). The initial denaturation was for 5min at 94°C; followed by 30s denaturation at the same temperature, annealing for 45 secs at 53°C, and extension at 72°C for 30 cycles. The PCR products were analyzed in agarose gel.The CP gene was purified post PCR and was cloned into pET-28a (+) vector between XhoI and NcoI sites and confirmed by sequencing (

Comparison of color-based feature extraction methods in banana leaf diseases classification using SVM and K-NN

“…Classification in banana plant using digital image processing has been widely used by researchers and expertise. This process is significant to identify and classify many banana diseases especially on banana leaf [1]. There are many stages to classify banana leaf disease using image processing namely image acquisition, pre-processing image, feature extraction and classification.…”

“…The average global banana production increases up to 116 million tons in 2017-2019 which approximate value of 31 billion USD. In Malaysia, banana is the most produced fruit which the production is around 350,000 tons per year [1]. According to Malaysia fruit crops statistic, the total hectares of banana planting in Malaysia are 30 thousand hectares including in East Malaysia.…”

Natural enemies of Pentalonia nigronervosa, vector of Banana Bunchy Top Virus

“…Banana plants infected with BBTV produce either no fruit or very poor quality fruit so that the disease has significant economic effect on the banana industry. Infected banana leaves are narrow, fragile, and close to each other to make a bunchy appearance (Sairam et al 2020). BBTV is found almost everywhere in Indonesia especially in Sumatera Island (Chiaki et al 2015).…”

Improvements in the Resistance of the Banana Species to Fusarium Wilt: A Systematic Review of Methods and Perspectives

“…Among banana improvement programs’ objectives are achieving cultivars resistant to abiotic stressors, such as salinity [ 8 , 9 ] and drought [ 10 , 11 , 12 ]. Another major challenge for the global production of Musaceae species is the development of cultivars resistant to biotic stressors, represented by their primary pests, the banana root borer ( Cosmopolites sordidus ) and the nematodes Meloidogyne spp., Pratylenchus coffeae , and Radopholus similis [ 13 , 14 , 15 , 16 , 17 , 18 , 19 ], and disease-causing pathogens, including banana bunchy top virus (BBTV) [ 20 , 21 ], Xanthomonas vasicola pv. musacearum causing bacterial wilt [ 22 , 23 , 24 , 25 ], Pseudocercospora fijiensis causing black Sigatoka [ 26 , 27 , 28 , 29 ], and Fusarium oxysporum f. sp.…”