Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

No abstract

OBJECTIVE:To investigate whether skeletal muscle gene expression of calpain 3 is related to obesity and insulin resistance. DESIGN: Cross-sectional studies in 27 non-diabetic human subjects and in Psammomys obesus, a polygenic animal model of obesity and type 2 diabetes. MEASUREMENTS: Expression of CAPN3 in skeletal muscle was measured using Taqman fluorogenic PCR. In the human subjects, body composition was assessed by DEXA and insulin sensitivity was measured by euglycemic -hyperinsulinemic clamp. In Psammomys obesus, body composition was determined by carcass analysis, and substrate oxidation rates, physical activity and energy expenditure were measured by whole-body indirect calorimetry. RESULTS: In human subjects, calpain 3 gene expression was negatively correlated with total (P ¼ 0.022) and central abdominal fat mass (P ¼ 0.034), and with blood glucose concentration in non-obese subjects (P ¼ 0.017). In Psammomys obesus, calpain 3 gene expression was negatively correlated with circulating glucose (P ¼ 0.013) and insulin (P ¼ 0.034), and with body fat mass (P ¼ 0.049). Indirect calorimetry revealed associations between calpain 3 gene expression and carbohydrate oxidation (P ¼ 0.009) and energy expenditure (P ¼ 0.013). CONCLUSION=INTERPRETATION: Lower levels of expression of calpain 3 in skeletal muscle were associated with reduced carbohydrate oxidation and elevated circulating glucose and insulin concentrations, and also with increased body fat and in particular abdominal fat. Therefore, reduced expression of calpain 3 in both humans and Psammomys obesus was associated with phenotypes related to obesity and insulin resistance.

No abstract