Mental retardation and epilepsy often occur together. They are both heterogeneous conditions with acquired and genetic causes. Where causes are primarily genetic, major advances have been made in unraveling their molecular basis. The human X chromosome alone is estimated to harbor more than 100 genes that, when mutated, cause mental retardation. At least eight autosomal genes involved in idiopathic epilepsy have been identified, and many more have been implicated in conditions where epilepsy is a feature. We have identified mutations in an X chromosome-linked, Aristaless-related, homeobox gene (ARX), in nine families with mental retardation (syndromic and nonspecific), various forms of epilepsy, including infantile spasms and myoclonic seizures, and dystonia. Two recurrent mutations, present in seven families, result in expansion of polyalanine tracts of the ARX protein. These probably cause protein aggregation, similar to other polyalanine and polyglutamine disorders. In addition, we have identified a missense mutation within the ARX homeodomain and a truncation mutation. Thus, it would seem that mutation of ARX is a major contributor to X-linked mental retardation and epilepsy.

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cyto-genetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Mutations in genes encoding chromatin-remodeling proteins, such as the ATRX gene, underlie a number of genetic disorders including several X-linked mental retardation syndromes; however, the role of these proteins in normal CNS development is unknown. Here, we used a conditional gene-targeting approach to inactivate Atrx, specifically in the forebrain of mice. Loss of ATRX protein caused widespread hypocellularity in the neocortex and hippocampus and a pronounced reduction in forebrain size. Neuronal "birthdating" confirmed that fewer neurons reached the superficial cortical layers, despite normal progenitor cell proliferation. The loss of cortical mass resulted from a 12-fold increase in neuronal apoptosis during early stages of corticogenesis in the mutant animals. Moreover, cortical progenitors isolated from Atrx-null mice undergo enhanced apoptosis upon differentiation. Taken together, our results indicate that ATRX is a critical mediator of cell survival during early neuronal differentiation. Thus, increased neuronal loss may contribute to the severe mental retardation observed in human patients.

No abstract

We have identified truncating mutations in the human DLG3 (neuroendocrine dlg) gene in 4 of 329 families with moderate to severe X-linked mental retardation. DLG3 encodes synapse-associated protein 102 (SAP102), a member of the membrane-associated guanylate kinase protein family. Neuronal SAP102 is expressed during early brain development and is localized to the postsynaptic density of excitatory synapses. It is composed of three amino-terminal PDZ domains, an src homology domain, and a carboxyl-terminal guanylate kinase domain. The PDZ domains interact directly with the NR2 subunits of the NMDA glutamate receptor and with other proteins responsible for NMDA receptor localization, immobilization, and signaling. The mutations identified in this study all introduce premature stop codons within or before the third PDZ domain, and it is likely that this impairs the ability of SAP102 to interact with the NMDA receptor and/or other proteins involved in downstream NMDA receptor signaling pathways. NMDA receptors have been implicated in the induction of certain forms of synaptic plasticity, such as long-term potentiation and long-term depression, and these changes in synaptic efficacy have been proposed as neural mechanisms underlying memory and learning. The disruption of NMDA receptor targeting or signaling, as a result of the loss of SAP102, may lead to altered synaptic plasticity and may explain the intellectual impairment observed in individuals with DLG3 mutations.

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Two families, originally diagnosed as having nonsyndromic X-linked mental retardation (NSXLMR), were reviewed when it was shown that they had a 24-bp duplication (428-45 1dup(24bp)) in the ARX gene [Stromme et al., 2002: Nat Genet 30:441-445]. This same duplication had also been found in three other families: one with X-linked infantile spasms and hypsarrhythmia (X-linked West syndrome, MIM 308350) and two with XLMR and dystonic movements of the hands (Partington syndrome, MIM 309510). On review, manifestations of both West and Partington syndromes were found in some individuals from both families. In addition, it was found that one individual had autism and two had autistic behavior, one of whom had epilepsy. The degree of mental retardation ranged from mild to severe. A GCG trinucleotide expansion (GCG)10+7 and a deletion of 1,517 bp in the ARX gene have also been found in association with the West syndrome, and a missense mutation (1058C>T) in a family with a newly recognized form of myoclonic epilepsy, severe mental retardation, and spastic paraplegia [Scheffer et al., 2002: Neurology, in press]. Evidently all these disorders are expressions of mutations in the same gene. It remains to be seen what proportions of patients with infantile spasms, focal dystonia, autism, epilepsy, and nonsyndromic mental retardation are accounted for by mutations in the ARX gene.

Cross-ethnic genetic studies can leverage power from differences in disease epidemiology and population-specific genetic architecture. In particular, the differences in linkage disequilibrium and allele frequency patterns across ethnic groups may increase gene-mapping resolution. Here we use cross-ethnic genetic data in sporadic amyotrophic lateral sclerosis (ALS), an adult-onset, rapidly progressing neurodegenerative disease. We report analyses of novel genome-wide association study data of 1,234 ALS cases and 2,850 controls. We find a significant association of rs10463311 spanning GPX3-TNIP1 with ALS (p = 1.3 × 10−8), with replication support from two independent Australian samples (combined 576 cases and 683 controls, p = 1.7 × 10−3). Both GPX3 and TNIP1 interact with other known ALS genes (SOD1 and OPTN, respectively). In addition, GGNBP2 was identified using gene-based analysis and summary statistics-based Mendelian randomization analysis, although further replication is needed to confirm this result. Our results increase our understanding of genetic aetiology of ALS.