Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cyto-genetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.
tRNA modifications are crucial for efficient and accurate protein synthesis, and modification defects are frequently associated with disease. Yeast trm7Δ mutants grow poorly due to lack of 2'-O-methylated C32 (Cm32) and Gm34 on tRNAPhe, catalyzed by Trm7-Trm732 and Trm7-Trm734 respectively, which in turn results in loss of wybutosine at G37. Mutations in human FTSJ1, the likely TRM7 homolog, cause non-syndromic X-linked intellectual disability (NSXLID), but the role of FTSJ1 in tRNA modification is unknown. Here we report that tRNAPhe from two genetically independent cell lines of NSXLID patients with loss of function FTSJ1 mutations nearly completely lacks Cm32 and Gm34, and has reduced peroxywybutosine (o2yW37). Additionally, tRNAPhe from an NSXLID patient with a novel FTSJ1-p.A26P missense allele specifically lacks Gm34, but has normal levels of Cm32 and o2yW37. tRNAPhe from the corresponding Saccharomyces cerevisiae trm7-A26P mutant also specifically lacks Gm34, and the reduced Gm34 is not due to weaker Trm734 binding. These results directly link defective 2'-O-methylation of the tRNA anticodon loop to FTSJ1 mutations, suggest that the modification defects cause NSXLID, and may implicate Gm34 of tRNAPhe as the critical modification. These results also underscore the widespread conservation of the circuitry for Trm7-dependent anticodon loop modification of eukaryotic tRNAPhe.
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
It is estimated that ∼1% of the world's population has intellectual disability, with males affected more often than females. is an X-linked gene encoding for the enzymeGlcNAc transferase (OGT), which carries out the reversible addition of -acetylglucosamine (GlcNAc) to Ser/Thr residues of its intracellular substrates. Three missense mutations in the tetratricopeptide (TPR) repeats of OGT have recently been reported to cause X-linked intellectual disability (XLID). Here, we report the discovery of two additional novel missense mutations (c.775 G>A, p.A259T, and c.1016 A>G, p.E339G) in the TPR domain of OGT that segregate with XLID in affected families. Characterization of all five of these XLID missense variants of OGT demonstrates modest declines in thermodynamic stability and/or activities of the variants. We engineered each of the mutations into a male human embryonic stem cell line using CRISPR/Cas9. Investigation of the global GlcNAc profile as well as OGT andGlcNAc hydrolase levels by Western blotting showed no gross changes in steady-state levels in the engineered lines. However, analyses of the differential transcriptomes of the OGT variant-expressing stem cells revealed shared deregulation of genes involved in cell fate determination and liver X receptor/retinoid X receptor signaling, which has been implicated in neuronal development. Thus, here we reveal two additional mutations encoding residues in the TPR regions of OGT that appear causal for XLID and provide evidence that the relatively stable and active TPR variants may share a common, unelucidated mechanism of altering gene expression profiles in human embryonic stem cells.
Neither the molecular basis for common fragile site DNA instability nor the contribution of this form of chromosomal instability to cancer is clearly understood. Fragile site FRA16D (16q23.2) is within regions of frequent loss-of-heterozygosity (LOH) in breast and prostate cancers, is associated with homozygous deletions in various adenocarcinomas and t(14;16) chromosomal translocations in multiple myeloma. The FOR (WWOX) gene spans FRA16D and encodes a partner of p53 that also has a role in apoptosis. Previously untested 53 cancer cell lines were screened for deletions within the FOR/WWOX gene. Deletions were detected in Co115, KM12C and KM12SM. Homozygous deletions in these and two previously identified tumour cell lines were intragenic on both alleles, indicating a distinct mutation mechanism from that causing LOH. Identical FRA16D deletions in two cell lines (one derived from the primary carcinoma and the other from a secondary metastasis) demonstrate that FRA16D DNA instability can be an early, transient event. Sequence analysis across one deletion locates one endpoint within a polymorphic AT-dinucleotide repeat and the other adjacent to an AT-rich mini-satellite repeat implicating AT-rich repeats in FRA16D DNA instability. Another deletion is associated with de novo repetition of the 9 bp AT-rich sequence at one of the deletion endpoints. FRA16D deleted cells retain cytogenetic fragile site expression indicating that the deletions are susceptible sites for breakage rather than regions that confer fragility. Most cell lines with FRA16D homozygous deletions also have FRA3B deletions, therefore common fragile sites represent highly susceptible genome-wide targets for a distinct form of mutation.
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded approximately 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
RLIM, also known as RNF12, is an X-linked E3 ubiquitin ligase acting as a negative regulator of LIM-domain containing transcription factors and participates in X-chromosome inactivation (XCI) in mice. We report the genetic and clinical findings of 84 individuals from nine unrelated families, eight of whom who have pathogenic variants in RLIM (RING finger LIM domain-interacting protein). A total of 40 affected males have X-linked intellectual disability (XLID) and variable behavioral anomalies with or without congenital malformations. In contrast, 44 heterozygous female carriers have normal cognition and behavior, but eight showed mild physical features. All RLIM variants identified are missense changes cosegregating with the phenotype and predicted to affect protein function. Eight of the nine altered amino acids are conserved and lie either within a domain essential for binding interacting proteins or in the C-terminal RING finger catalytic domain. In vitro experiments revealed that these amino acid changes in the RLIM RING finger impaired RLIM ubiquitin ligase activity. In vivo experiments in rlim mutant zebrafish showed that wild type RLIM rescued the zebrafish rlim phenotype, whereas the patient-specific missense RLIM variants failed to rescue the phenotype and thus represent likely severe loss-of-function mutations. In summary, we identified a spectrum of RLIM missense variants causing syndromic XLID and affecting the ubiquitin ligase activity of RLIM, suggesting that enzymatic activity of RLIM is required for normal development, cognition and behavior.
The association of RNF113A mutation with non-photosensitive TTD identifies a new locus for these disorders on the X chromosome. The extended phenotype within this family includes panhypopituitarism, cutis marmorata and congenital short oesophagus.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.