Type 2 immunity, which involves coordinated regulation of innate and adaptive immune responses, can protect against helminth parasite infection, but may lead to allergy and asthma after inappropriate activation. We demonstrate that il25−/− mice display inefficient Nippostrongylus brasiliensis expulsion and delayed cytokine production by T helper 2 cells. We further establish a key role for interleukin (IL)-25 in regulating a novel population of IL-4–, IL-5–, IL-13–producing non–B/non–T (NBNT), c-kit+, FcɛR1− cells during helminth infection. A deficit in this population in il25−/− mice correlates with inefficient N. brasiliensis expulsion. In contrast, administration of recombinant IL-25 in vivo induces the appearance of NBNT, c-kit+, FcɛR1− cells and leads to rapid worm expulsion that is T and B cell independent, but type 2 cytokine dependent. We demonstrate that these IL-25–regulated cells appear rapidly in the draining lymph nodes, implicating them as a source of type 2 cytokines during initiation of worm expulsion.

The identification of the genes associated with chromosomal translocation breakpoints has fundamentally changed our understanding of the molecular basis of hematological malignancies. By contrast, the study of chromosomal deletions has been hampered by the large number of genes deleted and the complexity of their analysis. We report the generation of a mouse model for the human 5q− syndrome using large-scale chromosomal engineering. Haploinsufficiency of the Cd74 – Nid67 interval (containing the Ribosomal protein S14 gene – Rps14) causes macrocytic anemia, prominent erythroid dysplasia and monolobulated megakaryocytes in the bone marrow. This is associated with defective bone marrow progenitor development, increased apoptosis and the appearance of bone marrow cells expressing high levels of p53. Notably, intercrossing with p53-deficient mice, completely rescues the progenitor cell defect, restoring CMP/MEP, GMP and HSC bone marrow populations. This novel mouse model suggests that a p53-dependent mechanism underlies the pathophysiology of the 5q− syndrome.

Linkage disequilibrium (LD) provides information about positional cloning, linkage, and evolution that cannot be inferred from other evidence, even when a correct sequence and a linkage map based on more than a handful of families become available. We present theory to construct an LD map for which distances are additive and population-specific maps are expected to be approximately proportional. For this purpose, there is only a modest difference in relative efficiency of haplotypes and diplotypes: resolving the latter into 2-locus haplotypes has significant cost or error and increases information by about 50%. LD maps for a cold spot in 19p13.3 and a more typical region in 3q21 are optimized by interval estimates. For a random sample and trustworthy map the value of LD at large distance can be predicted reliably from information over a small distance and does not depend on the evolutionary variance unless the sample size approaches the population size. Values of the association probability that can be distinguished from the value at large distance are determined not by population size but by time since a critical bottleneck. In these examples, omission of markers with significant HardyWeinberg disequilibrium does not improve the map, and widely discrepant draft sequences have similar estimates of the genetic parameters. The LD cold spot in 19p13.3 gives an unusually high estimate of time, supporting an argument that this relationship is general. As predicted for a region with ancient haplotypes or uniformly high recombination, there is no clear evidence of LD clustering. On the contrary, the 3q21 region is resolved into alternating blocks of stable and decreasing LD, as expected from crossover clustering. Construction of a genomewide LD map requires data not yet available, which may be complemented but not replaced by a catalog of haplotypes. P ositional cloning of genes for disease susceptibility depends on linkage and ''allelic association'' (also called ''linkage disequilibrium'' or LD). A cold spot for LD is an interval in which LD declines rapidly with distance: neither linkage nor LD is proportional to the sequence-based map. To the extent that LD mirrors recombination it can extend the low resolution of linkage: a cold spot for LD is a hot spot for recombination and vice versa. However, this correspondence is disturbed by other factors that cannot be reliably predicted. To the extent that these phenomena are important, both the physical and linkage maps are unreliable guides to LD. We need an LD map to facilitate positional cloning, extend the resolution of the linkage map, compare populations, infer their paleodemography, and detect selective sweeps and other events of evolutionary interest. LD mapping is at the stage of linkage maps nearly a century ago, with the same promise.The definitive property of a chromosome map, whether physical or genetic, is that its distances are additive. With this constraint, we require a standard LD map to which populationspecific maps are approximately proportional. Here...

Purpose:The organic cation transporter OCT-1mediates active transport of imatinib.We recently showed that low OCT-1activity is a major contributor to suboptimal response in chronic myeloid leukemia (CML) patients treated with imatinib. The relevance of OCT-1activity and efflux pumps in determining intracellular uptake and retention (IUR) of dasatinib was assessed. Experimental Design: The effect of OCT inhibitors on [ 14 C]dasatinib and [ 14 C]imatinib IUR was compared using peripheral blood mononuclear cells from newly diagnosed CML patients. The role of efflux transporters was studied using ABCB1-and ABCG2-overexpressing cell lines and relevant inhibitors. Results: Unlike imatinib, there was no significant difference in the dasatinib IUR at 37jC and 4jC (P = 0.8), and OCT-1 inhibitors including prazosin did not reduce dasatinib IUR significantly. In CML mononuclear cells, prazosin inhibitable IUR was significantly higher for imatinib than dasatinib (6.38 versus 1.48 ng/200,000 cells; P = 0.002; n = 11). Patients with high OCT-1 activity based on their imatinib uptake had IC 50 dasatinib values equivalent to patients with low OCT-1acti-vity. Dasatinib IUR was significantly lower in ABCB1-overexpressing cell lines compared with parental cell lines (P < 0.05). PSC833 (ABCB1inhibitor) significantly increased the dasatinib IUR (P < 0.05) and reduced IC 50 dasatinib (from 100 to 8 nmol/L) in K562-DOX cell line. The ABCG2 inhibitor Ko143 significantly increased dasatinib IUR in ABCG2-overexpressing cell lines and reduced IC 50 dasatinib . Conclusion: Unlike imatinib, dasatinib cellular uptake is not significantly affected by OCT-1 activity, so that expression and function of OCT-1 is unlikely to affect response to dasatinib. Dasatinib is a substrate of both efflux proteins, ABCB1and ABCG2.

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

The Marfan syndrome appears to be caused by mutations in a single fibrillin gene on chromosome 15. Diagnosis of the Marfan syndrome by genetic linkage and analysis is now feasible in many families.

The era of targeted therapies has seen significant improvements in depth of response, progression-free survival, and overall survival for patients with multiple myeloma. Despite these improvements in clinical outcome, patients inevitably relapse and require further treatment. Drug-resistant dormant myeloma cells that reside in specific niches within the skeleton are considered a basis of disease relapse but remain elusive and difficult to study. Here, we developed a method to sequence the transcriptome of individual dormant myeloma cells from the bones of tumor-bearing mice. Our analyses show that dormant myeloma cells express a distinct transcriptome signature enriched for immune genes and, unexpectedly, genes associated with myeloid cell differentiation. These genes were switched on by coculture with osteoblastic cells. Targeting AXL, a gene highly expressed by dormant cells, using small-molecule inhibitors released cells from dormancy and promoted their proliferation. Analysis of the expression of AXL and coregulated genes in human cohorts showed that healthy human controls and patients with monoclonal gammopathy of uncertain significance expressed higher levels of the dormancy signature genes than patients with multiple myeloma. Furthermore, in patients with multiple myeloma, the expression of this myeloid transcriptome signature translated into a twofold increase in overall survival, indicating that this dormancy signature may be a marker of disease progression. Thus, engagement of myeloma cells with the osteoblastic niche induces expression of a suite of myeloid genes that predicts disease progression and that comprises potential drug targets to eradicate dormant myeloma cells.

Netherton syndrome is an autosomal recessive multisystemic disorder characterized by congenital ichthyosiform erythroderma, hair shaft defects and atopy, caused by mutations within the human SPINK5 gene. To investigate the development of this disease, we have cloned mouse spink5 and created mice with a mutated premature stop codon at amino acid R820X, to produce an allele that closely mimics a point mutation (E827X) in human SPINK5. Newborn spink5(R820X/R820X) mice develop a lethal, severe ichthyosis with a loss of skin barrier function and dehydration, resulting in death within a few hours of birth, similar to that observed in patients with severe Netherton syndrome. Epidermal barrier function is compromised because of the stratum corneum becoming spontaneously detached in the newborn mice, and this is probably compounded by the reduced mechanical strength detected in the cornified envelopes. Biochemical analysis of skin from newborn wild-type and spink5(R820X/R820X) mice revealed a substantial increase in the proteolytic processing of profilaggrin into its constituent filaggrin monomers. Filaggrin functions to organize keratin filaments into highly ordered macrofibrils that crisscross the cornified cells of the stratum corneum imparting structural integrity, and defects in filaggrin processing occur in a number of forms of congenital ichthyosis. These data suggest that in the absence of the serine protease inhibitor spink5, there is an abnormal increase in the processing of profilaggrin, resulting in an overabundance of filaggrin monomers, and that this may play a direct role in the observed deficit in the adhesion of the stratum corneum and the severely compromised epidermal barrier function.