Act 1986 with 2012 amendments. The KINGS mice (C57BL/ 6J-Ins2,Kings.; Mouse Genome Informatics [MGI]: 6449740) were discovered in a colony with a C57BL/6J background and maintained on this background. Heterozygous males and females were studied from weaning until 20 weeks of age. In one study, KINGS mice were compared with Ins2 1/Akita (Akita) mice, which were obtained from The Jackson Laboratory (stock #003548, MGI: 1857572; Bar Harbor, ME) and maintained on the C57BL/6J background by in-house breeding. All mice were kept in standard laboratory conditions with a 12-h light/dark cycle. They had access to water and standard chow ad libitum, unless otherwise stated. Nesting material, shelters, and tunnels were provided in the cages as enrichment. According to our ethical guidelines, any animal losing 20% body weight was killed. Genotyping Ear clips were digested using lysis buffer (10% 103 Gitschier buffer, 0.5% Triton X-100, 1% b-mercaptoethanol, 2% 50 mg/mL proteinase K). The Kompetitive allele-specific PCR (KASP; LGC, Hoddesdon, U.K.) was used to determine genotype. Forward primers with fluorescent tags corresponding to the wild-type Ins2 (GAAGGTGACCAAGTTCATGCTTTTG TCAAGCAGCACCTTTGTG, FAM fluorophore) and KINGS mutant (GAAGGTCGGAGTCAACGGATTGCTTTTGTCAAG-CAGCACCTTTGTA, HEX fluorophore), with a common reverse primer for Ins2 (AGAGCCTCCACCAGGTGGGAA), were used. PCR was carried out using a LightCycler 480 (Roche, Basel, Switzerland) to give different fluorescent signals corresponding to wild-type, heterozygous, or homozygous genotypes. Animal Monitoring Random morning (9:00 A.M.) blood glucose concentrations and body weights were measured between weaning (3 weeks)

Diabetes mellitus is characterised by hyperglycaemia, which results from an absolute or relative lack of insulin. Chronic and acute hyperglycaemia are associated with a range of health complications and an overall increased risk of mortality. Mouse models are vital in understanding the pathogenesis of this disease and its complications, as well as for developing new diabetes therapeutics. However, for experimental questions to be suitably tested, it is critical that factors inherent to the animal model are considered, as these can have profound impacts on experimental outcome, data reproducibility and robustness. In this review, we discuss key considerations relating to model choice, physiological characteristics (such as age, sex and genetic background) and husbandry practices and explore the impact of these on common experimental readouts used in preclinical diabetes research.

Mice are used extensively in preclinical diabetes research to model various aspects of blood glucose homeostasis. Careful experimental design is vital for maximising welfare and improving reproducibility of data. Alongside decisions regarding physiological characteristics of the animal cohort (e.g., sex, strain and age), experimental protocols must also be carefully considered. This includes choosing relevant end points of interest and understanding what information they can provide and what their limitations are. Details of experimental protocols must, therefore, be carefully planned during the experimental design stage, especially considering the impact of researcher interventions on preclinical end points. Indeed, in line with the 3Rs of animal research, experiments should be refined where possible to maximise welfare. The role of welfare may be particularly pertinent in preclinical diabetes research as blood glucose concentrations are directly altered by physiological stress responses. Despite the potential impact of variations in experimental protocols, there is distinct lack of standardisation and consistency throughout the literature with regards to several experimental procedures including fasting, cage changing and glucose tolerance test protocol. This review firstly highlights practical considerations with regard to the choice of end points in preclinical diabetes research and the potential for novel technologies such as continuous glucose monitoring and glucose clamping techniques to improve data resolution. The potential influence of differing experimental protocols and in vivo procedures on both welfare and experimental outcomes is then discussed with focus on standardisation, consistency and full disclosure of methods.

No abstract

Aims Beta cell endoplasmic reticulum (ER) stress can cause cellular death and dysfunction and has been implicated in the pathogenesis of diabetes. Animal models of beta cell ER stress are critical in further understanding this and for testing novel diabetes therapeutics. The KINGS mouse is a model of beta cell ER stress driven by a heterozygous mutation in Ins2. In this study, we investigated how beta cell ER stress in the KINGS mouse drives diabetes. Methods We investigated whether the unfolded protein response (UPR) was activated in islets isolated from male and female KINGS mice and whether this impacted beta cell mass and turnover. Results Whilst the UPR was up‐regulated in KINGS islets, with increased protein expression of markers of all three UPR arms, this was not associated with a mass loss of beta cells; beta cell apoptosis rates did not increase until after the development of overt diabetes, and did not lead to substantial changes in beta cell mass. Conclusion We propose that the KINGS mouse represents a model where beta cell maladaptive UPR signalling drives diabetes development without causing mass beta cell loss.