The KINGS Ins2+/G32S Mouse: A Novel Model of β-Cell Endoplasmic Reticulum Stress and Human Diabetes

Abstract

Act 1986 with 2012 amendments. The KINGS mice (C57BL/ 6J-Ins2,Kings.; Mouse Genome Informatics [MGI]: 6449740) were discovered in a colony with a C57BL/6J background and maintained on this background. Heterozygous males and females were studied from weaning until 20 weeks of age. In one study, KINGS mice were compared with Ins2 1/Akita (Akita) mice, which were obtained from The Jackson Laboratory (stock #003548, MGI: 1857572; Bar Harbor, ME) and maintained on the C57BL/6J background by in-house breeding. All mice were kept in standard laboratory conditions with a 12-h light/dark cycle. They had access to water and standard chow ad libitum, unless otherwise stated. Nesting material, shelters, and tunnels were provided in the cages as enrichment. According to our ethical guidelines, any animal losing 20% body weight was killed. Genotyping Ear clips were digested using lysis buffer (10% 103 Gitschier buffer, 0.5% Triton X-100, 1% b-mercaptoethanol, 2% 50 mg/mL proteinase K). The Kompetitive allele-specific PCR (KASP; LGC, Hoddesdon, U.K.) was used to determine genotype. Forward primers with fluorescent tags corresponding to the wild-type Ins2 (GAAGGTGACCAAGTTCATGCTTTTG TCAAGCAGCACCTTTGTG, FAM fluorophore) and KINGS mutant (GAAGGTCGGAGTCAACGGATTGCTTTTGTCAAG-CAGCACCTTTGTA, HEX fluorophore), with a common reverse primer for Ins2 (AGAGCCTCCACCAGGTGGGAA), were used. PCR was carried out using a LightCycler 480 (Roche, Basel, Switzerland) to give different fluorescent signals corresponding to wild-type, heterozygous, or homozygous genotypes. Animal Monitoring Random morning (9:00 A.M.) blood glucose concentrations and body weights were measured between weaning (3 weeks)

Regulation of lipid metabolism by the unfolded protein response

“…Moreover, since UPR activation can lead to cell type‐specific responses, organ‐specific studies (eg in liver, pancreas, kidneys and white adipose tissue) will be informative in developing therapeutic approaches based on modulation of UPR sensors. To that end, new in vivo models such as the recently developed KINGS Ins2 +/G32S mouse model of human diabetes will be invaluable 113 …”

“…To that end, new in vivo models such as the recently developed KINGS Ins2 +/G32S mouse model of human diabetes will be invaluable. 113 Taken together, this review highlights a crucial role for UPR in the coordination of lipid metabolism and metabolic reprogramming and suggests this is an important area for further research in relevant diseases.…”

Distinct states of proinsulin misfolding in MIDY

“…The trafficking defect of the newly described proinsulin-G(B8)V is severe and very similar to that of the G(B8)S mutation (Supplemental Fig. S6), which has been recently described to account for spontaneous diabetes in the KINGS diabetic mouse [38], as well as being one of the first described human MIDY mutants [25]-its folding defect is considered further, below. Additionally, it might be predicted that proinsulin-Y(B26)C and L(A16)P (also discussed further, below) would be catastrophically detrimental to folding as they (in addition to position B8) fall among the more conserved residues within insulin (Fig.…”

“…G(B8), invariant among vertebrate insulins, insulin-like growth factors (IGFs) and relaxins, lacks a side chain but exhibits a critical positive ϕ dihedral angle ordinarily forbidden to L-amino acids [23]. From in vitro folding studies, any L-amino-acid substitution in this position predisposes to impaired disulfide pairing [45] as observed for the G(B8)S MIDY mutant [46], triggering permanent neonatal diabetes [25,38]. We posit that G(B8)V similarly enforces an inappropriate negative B8 ϕ dihedral angle, in turn misorienting the side chain of Cys(B7), which cannot be rescued by the lose-A6/A11 template.…”

Predisposition to Proinsulin Misfolding as a Genetic Risk to Diet-Induced Diabetes

“…Several groups have been pursuing the molecular mechanism(s) underlying the β-cell dysfunction and compensatory cellular response(s) in the rare genetic syndrome of Mutant INS-gene induced Diabetes of Youth (MIDY) (1)(2)(3). The fundamental defect in MIDY is observed in humans (4), large animal models (5), small animal models (6), and has been replicated in cell culture (7), in vitro (8) and modeled in silico (9). The clinical problem originates from the fact that misfolded proinsulin within the endoplasmic reticulum (ER) can propagate its misfolding and ER retention onto wild-type (WT) bystander proinsulin molecules, thereby impairing insulin production (10; 11).…”