We have previously demonstrated that coculture of islets with mesenchymal stromal cells (MSCs) enhanced islet insulin secretory capacity in vitro, correlating with improved graft function in vivo. To identify factors that contribute to MSC-mediated improvements in islet function, we have used an unbiased quantitative RT-PCR screening approach to identify MSC-derived peptide ligands of G-protein-coupled receptors that are expressed by islets cells. We demonstrated high expression of annexin A1 (ANXA1) mRNA by MSCs and confirmed expression at the protein level in lysates and MSCconditioned media by Western blot analysis and ELISA. Preculturing islets with exogenous ANXA1 enhanced glucose-stimulated insulin secretion (GSIS), thereby mimicking the beneficial influence of MSC preculture in vitro. Small interfering RNA-mediated knockdown of ANXA1 in MSCs reduced their capacity to potentiate GSIS. MSCs derived from ANXA1 2/2 mice had no functional capacity to enhance GSIS, in contrast to wild-type controls. Preculturing islets with ANXA1 had modest effects on their capacity to regulate blood glucose in streptozotocininduced diabetic mice, indicating that additional MSCderived factors are required to fully mimic the beneficial effects of MSC preculture in vivo. These findings demonstrate the feasibility of harnessing the MSC secretome as a defined, noncellular strategy to improve the efficiency of clinical islet transplantation protocols.There is a growing body of evidence that mesenchymal stromal cells (MSCs) can enhance the functional survival of islet grafts after transplantation, offering a potential therapeutic method for improving the outcomes of islet transplantation as a therapy for type 1 diabetes. A number of MSC-derived trophic factors have been shown to influence the graft niche by modifying the responses of host immune, endothelial, or progenitor cells to reduce inflammatory or immune responses (1,2) and to improve graft revascularization (3-5). However, we (6-8) and others (4,9-11) have demonstrated that MSCs also have direct effects on donor islet cells to improve their survival and secretory function. Thus, we previously used direct contact coculture of islets with MSCs derived from kidney (6) or adipose tissue (7) to enhance glucose-stimulated insulin secretion (GSIS) in vitro and demonstrated that this results in superior in vivo function for islet-alone grafts at the experimental renal subcapsular (6) and clinically preferred intraportal transplantation site (7). Previous studies suggest that the beneficial effect of MSCs on islet function is at least partly mediated by soluble bioactive molecules (12), so we have now applied a nonbiased screening approach to identify novel MSCderived secretory products that may influence islet function. We have based the current screen on our recent demonstration that islets express 293 different G-proteincoupled receptors (GPCRs) that are known to be activated by more than 250 identified ligands (13). In this study, we have used a quantitative (q)RT-PCR approach to ...

Recent advancements in the production of hepatocytes from human pluripotent stem cells (hPSC‐Heps) afford tremendous possibilities for treatment of patients with liver disease. Validated current good manufacturing practice (cGMP) lines are an essential prerequisite for such applications but have only recently been established. Whether such cGMP lines are capable of hepatic differentiation is not known. To address this knowledge gap, we examined the proficiency of three recently derived cGMP lines (two hiPSC and one hESC) to differentiate into hepatocytes and their suitability for therapy. hPSC‐Heps generated using a chemically defined four‐step hepatic differentiation protocol uniformly demonstrated highly reproducible phenotypes and functionality. Seeding into a 3D poly(ethylene glycol)‐diacrylate fabricated inverted colloid crystal scaffold converted these immature progenitors into more advanced hepatic tissue structures. Hepatic constructs could also be successfully encapsulated into the immune‐privileged material alginate and remained viable as well as functional upon transplantation into immune competent mice. This is the first report we are aware of demonstrating cGMP‐compliant hPSCs can generate cells with advanced hepatic function potentially suitable for future therapeutic applications. stem cells translational medicine 2019;8:124&14

Act 1986 with 2012 amendments. The KINGS mice (C57BL/ 6J-Ins2,Kings.; Mouse Genome Informatics [MGI]: 6449740) were discovered in a colony with a C57BL/6J background and maintained on this background. Heterozygous males and females were studied from weaning until 20 weeks of age. In one study, KINGS mice were compared with Ins2 1/Akita (Akita) mice, which were obtained from The Jackson Laboratory (stock #003548, MGI: 1857572; Bar Harbor, ME) and maintained on the C57BL/6J background by in-house breeding. All mice were kept in standard laboratory conditions with a 12-h light/dark cycle. They had access to water and standard chow ad libitum, unless otherwise stated. Nesting material, shelters, and tunnels were provided in the cages as enrichment. According to our ethical guidelines, any animal losing 20% body weight was killed. Genotyping Ear clips were digested using lysis buffer (10% 103 Gitschier buffer, 0.5% Triton X-100, 1% b-mercaptoethanol, 2% 50 mg/mL proteinase K). The Kompetitive allele-specific PCR (KASP; LGC, Hoddesdon, U.K.) was used to determine genotype. Forward primers with fluorescent tags corresponding to the wild-type Ins2 (GAAGGTGACCAAGTTCATGCTTTTG TCAAGCAGCACCTTTGTG, FAM fluorophore) and KINGS mutant (GAAGGTCGGAGTCAACGGATTGCTTTTGTCAAG-CAGCACCTTTGTA, HEX fluorophore), with a common reverse primer for Ins2 (AGAGCCTCCACCAGGTGGGAA), were used. PCR was carried out using a LightCycler 480 (Roche, Basel, Switzerland) to give different fluorescent signals corresponding to wild-type, heterozygous, or homozygous genotypes. Animal Monitoring Random morning (9:00 A.M.) blood glucose concentrations and body weights were measured between weaning (3 weeks)

No abstract

The mechanisms responsible for painful and insensate diabetic neuropathy are not completely understood. Here, we have investigated sensory neuropathy in the mouse, a hereditary model of diabetes. Akita mice become diabetic soon after weaning, and we show that this is accompanied by an impaired mechanical and thermal nociception and a significant loss of intraepidermal nerve fibers. Electrophysiological investigations of skin-nerve preparations identified a reduced rate of action potential discharge in mechanonociceptors compared with wild-type littermates, whereas the function of low-threshold A-fibers was essentially intact. Studies of isolated sensory neurons demonstrated a markedly reduced heat responsiveness in dorsal root ganglion (DRG) neurons, but a mostly unchanged function of cold-sensitive neurons. Restoration of normal glucose control by islet transplantation produced a rapid recovery of nociception, which occurred before normoglycemia had been achieved. Islet transplantation also restored intraepidermal nerve fiber density to the same level as wild-type mice, indicating that restored insulin production can reverse both sensory and anatomical abnormalities of diabetic neuropathy in mice. The reduced rate of action potential discharge in nociceptive fibers and the impaired heat responsiveness of DRG neurons suggest that ionic sensory transduction and transmission mechanisms are modified by diabetes.