Background and Aim: Eimeria spp. are gastrointestinal protozoans that affect animal productivity, thereby causing symptoms that range from bloody diarrhea to death. These symptoms cause economic losses to farmers. The distribution of Eimeria spp. in cattle has, therefore, been reported to have spread widely, especially in the tropics and subtropics. Indonesia is a tropical country at high risk of Eimeria infections. This study aimed to identify the prevalence and risk factors related to the levels of eimeriosis in beef cattle originating from different geographic areas in Indonesia. Materials and Methods: Here, 817 fecal samples were collected from beef cattle in Indonesia, including 282 calves, 535 adults, 530 males, and 287 females. In addition, 156 semi-intensively and 661 intensively managed cattle were randomly collected. Then, fecal samples were analyzed by parasitology examinations. Results: Screening examination using the sugar flotation modification method showed that Eimeria spp. were prevalent in Indonesia, as 65.4% of the bacterial strain was detected. The prevalence of identified Eimeria spp. in Indonesia was highest in North Maluku (Maluku Island) (94.1%), whereas the lowest levels were observed in West Java (24.0%) (Java Island). The prevalence was also found to be higher in males (79.3%) than females (51.9%). Similarly, levels in semi-intensively managed cattle (66.7%) were higher than those subjected to intensive management (65.9%). However, its prevalence in calf and adult cattle was similar. Conclusion: Bovine eimeriosis spp. were detected at high prevalence in Indonesia, and high-level risks were observed in infected males, including those under the semi-intensive management. In addition, although the results from oocyst examinations were based on qualitative analysis, the endemicity levels of Eimeria spp. among farms in Indonesia should be considered because Eimeria spp. were distributed in most parts of Indonesia. Based on the results of this study, we provide the first information about the prevalence of bovine eimeriosis from different geographical locations in Indonesia, which have differing climates associated with the level of the existing risk factors. Hence, farmers are advised to pay more attention to strict biosecurity techniques on their farms, thereby favoring the early control of bovine eimeriosis.
Eimeria bovis and Eimeria zuernii are highly pathogenic Eimeria species in cattle that are the most prevalent causes of a severe clinical illness characterized by hemorrhagic diarrhea in calves and young cattle with potentially fatal effects over the world. The oocysts of a handful of the known bovine eimeriosis species are difficult to distinguish morphologically. For the specific differentiating evidence of Eimeria species, symptomatic research institutions are increasingly relying on DNA-based technologies. This research offers a duplex polymerase chain reaction (PCR) test based on the internal transcribed spacer-1 (ITS-1) gene that may be used to diagnose E. bovis and E. zuernii in cattle from various locations at the same time. The oocysts were concentrated and purified using a fecal harvesting method. The genomic DNA is extracted according to the instructions included with the kit. Primer pairs specific to each species, as well as a standard optimum annealing temperature of 55°C for these species, were discovered. The samples were amplified in a homogenous way, resulting in a homogeneous band ladder, revealing that the test could distinguish between two highly pathogenic Eimeria species in one tube reaction. This duplex PCR assay can detect a high pathogenic bovine Eimeria simultaneously in a rapid and low cost.
Gastrointestinal nematode parasites play an important role in cattle farming in Indonesia. The majority of parasite infection cases cause weight loss and decreases in appetite, productivity, milk production and farmers’ economic income. This study aimed at finding out the incidence of gastrointestinal nematode parasite disease in cattle at several regions in Indonesia. It was conducted in the period of March 6th to October 2020. There were totally 335 samples randomly drawn from various regions in 15 provinces of 34 provinces in Indonesia. Stool was examined using Whitlock and flotation methods. The results showed that the prevalence of gastrointestinal nematodes Strongyle, Trichuris sp., Capillaria sp., and Ascaris sp. amounted to 24.2%. The highest prevalence of the Strongyle nematodes was found in West Nusa Tenggara (52%), Central Kalimantan (50.8%) and Southeast Sulawesi (40%). The prevalence of the Trichuris sp. in East Java was 15%, while it was 10% in Central Kalimantan. The prevalence of the Capillaria sp. in North Kalimantan was 21.1%, in West Sumatra 18.8% and in East Java 6.7%. The prevalence of the Ascaris sp. worms in East Java was 16.7%. The results of the characterization based on age, sex and cattle management showed that 4.6% of the Strongyle worms were found in bulls, 2.74% in females, 4.38% in intensive maintenance and 2.47% in semi-intensive maintenance, while 5.48% of the worms were found in adult cattle and 1.37% in young cattle. The same pattern was observed in Trichuris sp., Capillaria sp. and Ascarids sp. infections. The results indicated the need for the eradication of the gastrointestinal nematodes through deworming and good management system.
Background and Aim: Paramphistomiasis is common in tropical countries such as Indonesia and affects livestock and various endemic wild animals such as Sumatran elephants. However, the specific species of paramphistomoid worm that causes paramphistomiasis are rarely reported. The study aims at identifying paramphistomoid worm that infects Sumatran elephants. Materials and Methods: Flukes were collected from the feces of five semi-captive Sumatran elephants that lived at Tegal Yoso Elephant Response Unit in Way Kambas National Park, in 2018, after treatment of oxyclozanide 1 g at the dose of approximately 5-8 mg/kg of body weight. Eight paramphistomoid worms were flattened and stained in Semichon's carmine for morphological identification, and five other worms were used for molecular identification at second internal transcribed spacer (ITS-2) of ribosomal deoxyribonucleic acid sequence. Results: Forty-five flukes were collected from five Sumatran elephants in Lampung, Indonesia. Eight paramphistomoid worms were morphologically identified as Pfenderius heterocaeca> and five isolates did not show any variation in ITS-2. Phylogenetic analysis showed that there was a close genetic relationship between our sample and Chiorchis fabaceus that had a family similar to the samples. Conclusion: Based on the morphological and molecular characteristics, the paramphistomoids found in Sumatran elephant on Way Kambas National Park are P. heterocaeca. Keywords: internal transcribed spacer-2, paramphistomiasis, Pfenderius spp., Sumatran elephant.
Background and Aim: Worms from nematodes are the most numerous and the most detrimental in elephants. Most adult worms are located in the digestive tract. Nematode infection is at higher risk in young elephants, which caused several cases such as anemia, hypoalbuminemia, enteritis, and even death. This study aimed to determine the morphology and morphometry of adult nematodes on Sumatran elephants in Way Kambas National Park area. Materials and Methods: Nematode samples were obtained from Sumatran elephants' feces (Elephas maximus sumatranus) in Way Kambas National Park, Lampung Province, after being given Kalbazen® containing albendazole 1000 mg at a dose of 10 mg/kg by the veterinarian in charge of the National Park area. For the morphological and morphometric examinations, we used an Olympus BX 51 microscope equipped with Olympus DP 12 camera and were conducted at the Parasitology Laboratory, Faculty of Veterinary Medicine, Universitas Gadjah Mada. The scanning electron microscopic (SEM) analysis was carried out at the Biology Research Center of the Indonesian Institute of Sciences (Lembaga Ilmu Pengetahuan Indonesia). Results: The results of macroscopic observations of the obtained nematodes showed that the nematodes which were found have the characteristics of round, slim, and white color. The size of a female worm was larger than a male worm. Microscopic examination in four anterior papillae indicated that the dorsal lobe in the copulatory bursa was longer than lateral lobe. The result of inspection with the SEM showed a leaf crown consisting of 10 elements, a pair of amphids laterally, and two pairs of papilla in a submedian region. Conclusion: Based on our morphology and morphometry examinations of adult nematodes in Sumatran elephant (E. maximus sumatranus) in Way Kambas National Park area, the adult nematodes which were found are species of Quilonia travancra.
This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed.
Background and Aim: Blood parasite infections in poultry, such as Plasmodium, are a serious threat to the poultry industry due to their potential to cause economic losses. To date, there has been inadequate research on the morphological and molecular detection of the different Plasmodium species that infect poultry in Indonesia. Therefore, this study aimed to analyze the morphological and molecular characteristics of Plasmodium spp. and the several predisposing factors for Plasmodium infection in layer chickens from three districts of Yogyakarta, Indonesia. Materials and Methods: One hundred and five blood samples from layer chickens were collected from 13 farms located in three districts of Yogyakarta (Sleman, Bantul, and Kulon Progo) between September and November 2022. Blood samples were subjected to microscopic and polymerase chain reaction (PCR) analyses. Sequencing was performed using basic local alignment search tools to identify the nucleotide structure of cytochrome b. Phylogenetic analysis of Plasmodium was performed using the MEGA-X software. Results: Microscopic examination revealed that 17/105 positives (16.19%) were positive for blood parasite infection. Trophozoites, erythrocytic meronts, and microgametocytes of Plasmodium were found in blood samples. Based on the morphological examination, the species found in the samples was close to Plasmodium juxtanucleare. Polymerase chain reaction examination revealed that 21/60 samples were positive for Plasmodium (35%). The Plasmodium species identified from the sequenced samples were proven to be P. juxtanucleare. The P. juxtanucleare from Thailand was closely related to samples (99.64%–100%) with a genetic distance of 0%–1%. In addition, age, population, and cage type were not significantly associated with Plasmodium infection. Conclusion: Based on microscopic and PCR examinations, the Plasmodium species found in the three districts of Yogyakarta was P. juxtanucleare. The genetic distance between samples from the three districts of Yogyakarta was closely related (0%–1%) to P. juxtanucleare from Thailand and Japan. There was no correlation between Plasmodium infection and age, cage type, or population. Keywords: avian malaria, cytochrome b gene, layer chicken, polymerase chain reaction.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.