No abstract

RESUMO.-O presente estudo foi conduzido com o objetivo de determinar as causas de fotossensibilização em ruminantes e equídeos no Nordeste do Brasil, através da revisão dos laudos de exames arquivados no Laboratório de Patologia Veterinária da Universidade Federal da Paraíba. Durante os quatro anos do estudo foram diagnosticados 22 surtos de fotossensibilização, incluindo 11 surtos de fotossensibilização primária e oito surtos de fotossensibilização hepatógena. A intoxicação por Froelichia humboldtiana foi a principal causa de fotossensibilização e a única causa de fotossensibilização primária. As espécies mais gravemente afetadas por fotossensibilização primária foram os asininos, caprinos, bovinos e ovinos, mas os equinos e mulas também são afetados. A intoxicação por Brachiaria decumbens foi a principal causa de fotossensibilização hepatógena e afetou apenas os ovinos e bovinos. Outras plantas associadas com fotossensibilização The study was conducted to determine the causes of photosensitization in ruminants and equidae in northeastern Brazil through a review of the files at the Laboratório de Patologia Veterinária of Universidade Federal da Paraíba. During four years of the study 22 outbreaks of photosensitization were diagnosed, including 11 outbreaks of primary photosensitization and eight outbreaks of hepatogenous photosensitization. Poisoning by Froelichia humboldtiana was the main cause of photosensitization, and the only cause of primary photosensitization. The most severely affected animals by primary photosensitization are donkeys, goats, cattle and sheep, but horses and mules may also be affected. Poisoning by Brachiaria decumbens was the main cause of hepatogenous photosensitization, and affected only sheep and cattle. Other plants associated with hepatogenous photosensitization in cattle include Enterolobium contortisiliquum and Lantana camara. Allergic dermatitis was diagnosed in two flocks of sheep and in a horse. The animals had chronic lesions characterized by areas of alopecia, crusts and hyperpigmentation on the head, around the eyes (sheep) and at the legs (horse). Itching was the main clinical sign in cases of primary photosensitization and insect hypersensitivity.

The objective of this study was to determine the prevalence of Tritrichomonas foetus infection and to evaluate risk factors associated with this infection among cattle in the state of Paraíba in northeastern Brazil. Samples of cervicovaginal mucus from 290 females and smegma from 59 males [beef, 31; mixed aptitude (beef and dairy), 10; and dairy, 18] from 31 farms were collected. Modified Diamond's medium and polymerase chain reaction (PCR) were used for the laboratory diagnosis of T. foetus infection. Univariate analysis and logistic regression were performed to test for potential risk factors in addition to prevalence mapping. No sample was positive for T. foetus in culture, and the prevalence of T. foetus infection using PCR was 3.7% (13/349) [confidence interval (CI) 95%, 2.1%-6.4%]. In total, 19.3% (6/31) of the farms had at least one animal positive for T. foetus. The contact of females with males from other farms [Odds ratio, 5.9; 95% CI, 1.5-22.4; p = 0.009] was identified as a risk factor for T. foetus infection. This study demonstrates that T. foetus infection is prevalent among dairy cows in the state of Paraíba, Brazil. Sexual resting, removal of positive females, and avoiding contact of females with males from other farms are recommended to reduce the risk of infection.

Pesq. Vet. Bras. 32(0):995-1000, outubro 2012 995 RESUMO.-Objetivou-se com o estudo caracterizar a situação epidemiológica da infecção por Toxoplasma gondii em equídeos na microrregião do Brejo Paraibano, região Nordeste do Brasil. Anticorpos contra T. gondii foram pesquisados em 257 amostras de equídeos (204 equinos, 46 muares e sete asininos) em 26 propriedades. Para o diagnóstico sorológico utilizou-se a Reação de Imunoϐluorescência Indireta (RIFI) e um ponto de corte de 1:64. O número de focos encontrado foi de 46,1%. Nas amostras analisadas, a prevalência geral foi de 7,8% (I.C. 4,8). A prevalência foi de 8,3% (I.C. 4,9-13,0) para os equinos, 2,2% (I.C. 0,1-11,5) para os muares e 28,6% (I.C. 3,7-71,0) entre os asininos. Na regressão logística das variáveis observou-se que a fonte de água foi um fator de risco, pois naquelas propriedades que forneciam água corrente para os animais o risco de infecção foi 4,4 vezes maior do que naquelas propriedades que forneciam água parada (OR 4,4; I.C. 1,0-19,0). Este é o primeiro relato da presença de anticorpos contra T. gondii em equídeos nessa microrregião do estado da Paraíba. Para

Abstract. The present study, the first to spatially characterize Leptospira spp. infection among equids in the Brejo Paraibano micro-region of the Paraiba state in the northeast of Brazil, investigated 257 animals in 26 farms properties. Serum samples from 204 horses, 46 mules and seven donkeys were serologically diagnosed using the microscopic agglutination test (MAT). The distribution of Leptospira spp. was studied by employing specific antigens from 24 different Leptospira serovars. All farms were georeferenced and their distribution visualised on a map of the Brejo Paraibano micro-region. In addition, rainfall data were obtained from the same year, in which the sampling was performed. Among the 20 farms found to harbour animals with leptospirosis, 14 (70%) exhibited low prevalence, five (25%) medium prevalence and one (5%), high prevalence. Certain areas had a higher density of infected farms and required intervention to control the infection. Many serovars were widely distributed, while others were more common in particular areas. There was no significant association between the prevalence of Leptospira spp. infection and rainfall.

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction  was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems.

The diagnosis of umbilical infections in neonates can be obtained from clinical signs, but the intracavitary involvement of structures and associated complications can be underestimated, compromising the establishment of adequate therapeutic approaches or prognosis. This case report presents the clinical, imaging, pathological and microbiological aspects of an umbilical infection in calves. Physical examination of the animal identified apathy, low body score, increased volume in the umbilical region and joints. The abdominal palpation identified firm structures in topography of the arteries and umbilical vein. Imaging examinations of the abdomen and joints were performed. Multiple, hyperechogenic focal structures have been identified in the liver, as well as cylindrical and firm structures in topography of the arteries and umbilical vein. In the joints, osteolytic changes, periosteal reactions, subchondral sclerosis and formation of osteophytes were seen. Umbilical panvasculitis triggered arthritis and an infectious process in the liver, the case being assessed as having an unfavorable prognosis and the animal being referred for euthanasia. At necropsy, multifocal abscesses were observed in the pleura, ribs, omentum, spleen and liver. There was granulomatous exudate in the urinary vesicle. The affected joints presented thickening of the joint capsule with the presence of exudate. In the microbiological analysis of liver fragments, urinary vesicle content and joint exudate, Proteus mirabilis with resistance to antimicrobials was identified. Imaging studies collaborated with the establishment of the prognosis and conduct adopted, and must, whenever possible, be included in the clinical examination. In case of death, necropsy allows a correct association of clinical signs and imaging findings.

RESUMO: O presente trabalho teve por objetivo avaliar a influência do tipo de parto sobre a transferência de imunidade passiva e de alguns constituintes séricos de cordeiros recém-nascidos, alimentados naturalmente com colostro materno, criados no semiárido paraibano em sistema extensivo. Foram utilizados 34 cordeiros clinicamente sadios, da raça Santa Inês, os quais foram identificados e pesados imediatamente após o nascimento e separados em dois grupos experimentais com 17 animais cada. O grupo PS (nove machos e oito fêmeas) formado por animais nascidos de partos simples e o grupo PG (seis machos e onze fêmeas) formado por cordeiros nascidos de partos gemelares. A ingestão de colostro se deu de forma natural e voluntária em suas respectivas mães. Foram coletados 10 mL de sangue de cada animal, mediante punção da veia jugular, em tubos siliconizados a vácuo, 48 horas após o nascimento. Após centrifugação, as alíquotas de soro foram separadas e permaneceram congeladas a -15°C até o momento das análises. Para o estudo comparativo dos constituintes séricos, foram constituídos dois grupos experimentais distribuídos em um delineamento inteiramente casualizado, no esquema fatorial 2x2 (tipo de parto e sexo). Os dados obtidos foram submetidos à análise de variância, cujas médias foram comparadas pelo teste de Tukey a 5%. Foram determinadas as atividades séricas das enzimas aspartato aminotransferase (AST) e gamaglutamiltransferase (GGT) e as concentrações séricas de proteína total, albumina, ureia, creatinina, cálcio, fósforo e magnésio, utilizando-se conjuntos de reagentes comerciais e as leituras das amostras em espectrofotômetro automático. As atividades séricas de AST, GGT e as concentrações séricas de proteína total, albumina e globulinas dos cordeiros dos grupos PS e PG não foram influenciadas pelo tipo de gestação e sexo. A partir da concentração sérica de proteína total, verificou-se falha de transferência de imunidade passiva (FTIP) nos cordeiros do grupo PG, utilizando-se o valor 5,0g/dL como ponto de corte. Com exceção do cálcio, as concentrações séricas da ureia, creatinina, fósforo e magnésio apresentaram o mesmo padrão de comportamento. Embora esses constituintes não tenham apresentado diferença significativa entre os grupos estudados e o sexo, pôde-se observar valores mais elevados nos animais nascidos de partos simples, sugerindo que a ausência de concorrência pela ingestão voluntária de colostro materno pode ter sido o fator determinante. Pode-se concluir que cordeiros Santa Inês nascidos de partos gemelares e criados extensivamente no semiárido paraibano apresentam falha na transferência de imunidade passiva e alterações/diminuições marcantes nos teores séricos de alguns constituintes bioquímicos, suscitando a necessidade de interferência humana nestes casos.