The objective of this study was to determine the prevalence of Tritrichomonas foetus infection and to evaluate risk factors associated with this infection among cattle in the state of Paraíba in northeastern Brazil. Samples of cervicovaginal mucus from 290 females and smegma from 59 males [beef, 31; mixed aptitude (beef and dairy), 10; and dairy, 18] from 31 farms were collected. Modified Diamond's medium and polymerase chain reaction (PCR) were used for the laboratory diagnosis of T. foetus infection. Univariate analysis and logistic regression were performed to test for potential risk factors in addition to prevalence mapping. No sample was positive for T. foetus in culture, and the prevalence of T. foetus infection using PCR was 3.7% (13/349) [confidence interval (CI) 95%, 2.1%-6.4%]. In total, 19.3% (6/31) of the farms had at least one animal positive for T. foetus. The contact of females with males from other farms [Odds ratio, 5.9; 95% CI, 1.5-22.4; p = 0.009] was identified as a risk factor for T. foetus infection. This study demonstrates that T. foetus infection is prevalent among dairy cows in the state of Paraíba, Brazil. Sexual resting, removal of positive females, and avoiding contact of females with males from other farms are recommended to reduce the risk of infection.
Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems.
This case study describes the cytological and histopathological findings of cutaneous masses in a bovine, including a peripheral nerve sheath tumor (PNST), vaccine-associated granulomatous inflammation, and eosinophilic inflammation due to parasitosis. A six-year-old undefined cow (SRD) presented with heterogeneous cutaneous lesions including multiple nodules in the left paralumbar fossa, bilaterally at the withers, and scattered along the dorsum, limbs and near the tail; some lesions were associated with ticks. Cytology of these nodules showed benign mesenchymal neoplasia (paralumbar fossa), granulomatous and pyogranulomatous inflammation (withers) and keratin (dorsum). Histopathology, in this order, confirmed PNST, post-vaccination granuloma, and eosinophilic dermatitis. A peripheral nerve sheath tumor was suspected based on the histological findings, showing a well-delineated proliferation of fusiform cells arranged in plexiform structures, which appeared red by Masson's Trichrome stain. The diagnosis was confirmed by immunohistochemistry (anti-S100 antibody). Vaccine reaction often occurs in cattle, and cytological examination is sufficient to determine the inflammatory process. Eosinophilic dermatitis is usually accompanied by perivascular inflammation and reflects the exfoliative process by the oral apparatus of the parasite. ResumoDescrevem-se os achados citológicos e histopatológicos do tumor de bainha de nervo periférico (TBNP), da reação vacinal e da inflamação eosinofílica decorrente dapicada de carrapatoem um bovino. Uma vaca sem raça definida (SRD) de seis anos de idade foi apresentada com diferentes lesões cutâneasnodulares localizadas na fossa paralombar esquerda, bilateralmente na cernelha e dispersos no dorso, membros e próximo à cauda, por vezes associado a carrapatos. Realizou-se citologia e biópsia desses nódulos. Na citologia verificou-se neoplasia mesenquimal benigna (fossa paralombar), inflamação granulomatosa e piogranulomatosa (cernelha) e ceratina (dorso). Na histopatologia, confirmou-se que esses nódulos correspondiam, nessa ordem, a tumor de bainha de nervo periférico, granuloma vacinal e dermatite eosinofílica. O diagnóstico do TBNP foi estabelecido com base nos achados histológicos, que caracterizaram-se por uma proliferação bem delimitada de células fusiformes arranjadas em estruturas plexiformes, corados em vermelho pelo Tricômico de Masson, e confirmado por imuno-histoquímica (anticorpo anti-S100). A reação vacinal ocorre frequentemente em bovinos e o exame citológico é suficiente para determinação do processo inflamatório. Dermatite eosinofílica em geral é acompanhada de inflamação perivascular e perianexal e reflete a ação esfoliativa do aparato bucal do parasita. Palavras-chave: Dermatopatia. Inflamação eosinofílica. Inflamação granulomatosa. Ruminante. Tumor de bainha do nervo periférico.
Teratomas rarely occur in domestic species, especially in cattle. These tumors originate in fetal life and are characterized by rapid growth, which justifies their frequent detection in young animals. This study reported a case of ovarian teratoma in a heifer. On physical examination, the main signs identified were apathy, abdominal distention and tension, empty rumen, and mushy diarrhea. During rectal palpation, a mass was identified in the pelvic region, which was suggestive of cysts on ultrasound examination. The animal underwent laparotomy, followed by euthanasia due to a poor prognosis. At necropsy, a 54 x 43 x 52 cm (length x width x thickness) tumor was observed in the right ovary with multiple cystic areas, in addition to masses associated with multiple adhesions of the intestinal loops and peritonitis. On histopathology, muscle, cartilage, bone, nervous and epithelial tissue, glands, hair with follicles, were identified in the affected ovary. There was mixed inflammation and foci of necrosis observed with a complete absence of ovarian architecture in both the ovaries. Infiltrations were identified in the lymph nodes and mesenteric vessels. Glandular ducts were seen from the serosa to the intestinal mucosa. A locally infiltrative and expansile ovarian teratoma was diagnosed accordingly. It is considered that this kind of tumor can induce abdominal distension and absence of estrus in previously healthy, non-pregnant heifers.
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
334 Leonard St
Brooklyn, NY 11211
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.