Key words: AIDS; HIV-1; Nef; CD4+ T cell; Cytotoxicity tion with nylon wool, and selective panning selection as described previously [16]. CD4+ T cells from lamina propria mononuclear cells (LPMCs) were a gift from Dr. M. Ito, Yamagata University School of Medicine. The T cells from PBMC and LPMC were cultured in Iscov's modified Dulbecco's medium (IMDM) containing 25 U/ml of rlL-2 and 10% heat-inactivated human AB serum (Gibco). Antibodies (Abs) and seraMouse monoclonal antibodies (mAbs), OKT-4 (anti-CD4) and OKT-8 (anti-CD8), were purchased from Ortho Diagnostic Inc.

RNA interference (RNAi) has been reported to be post‐transcriptional gene silencing (PTGS) by approximately 500 nucleotide‐(nt)‐long double‐stranded (ds) RNA that specifically targets homologous sequences of messenger RNA. In this report, we describe inhibition of HIV‐1 transcription by synthetic dsRNAs constructed with mutated nef genes (nef dsRNAs) derived from long‐term non‐progressors (LTNPs) using cotransfection of the target gene‐expressing plasmid and dsRNA. The effects of nef dsRNAs were examined with luciferase (Luc) reporter which is combined with the HIV‐1 (SF2) LTR in persistently HIV‐1‐infected T cell and macrophage cell lines. At 48 hr, a defective nef dsRNA (556 nt) suppressed Luc activity more potently than did SF2 full‐length nef dsRNA (744 nt), suggesting that approximately 500 nt‐long nef dsRNA could interfere with the HIV‐1 transcription.

No abstract

Nef may be involved in both viral replication and the wasting syndrome associated with AIDS.

Full-lengthThe genomic DNA of feline foamy virus (FFV) contains structural genes designated gag, pol and env, as well as the auxiliary gene bel (Helps & Harbour, 1997). These genes are located between two long terminal repeats (LTRs). Although this type of genome organization is common for foamy viruses (FVs) from several species of mammals, there are remarkable dissimilarities between FVs and other retroviruses in their mode of replication (Yu et al., 1996). For example, interactions between group-specific antigen (Gag) and envelope protein (Env) are essential for the assembly and budding of infectious FV particles (Pietschmann et al., 1999), whereas the Gag protein alone is sufficient to allow budding in cells infected with retroviruses other than FVs (Linial, 1999). Reports indicate that it is difficult to produce high titre pseudotyped FV bearing Author for correspondence : Yoichi Fujii.Fax j81 52 836 3430. e-mail fatfuji!hotmail.com glycoproteins from murine leukaemia virus Env or vesicular stomatitis virus G proteins (Lindemann et al., 1997 ;Hill et al., 1999). These observations indicate that the interaction between FV Gag and Env of different species of origin may be of interest when evaluating FVs as vector candidates for gene transfer. We report the isolation and sequencing of FFV clones SKY3.0 and SKY5.0. Furthermore, we show that a chimeric FFV clone (HFFV) bearing Env and a part of the trans-activator (Tas) from human foamy virus (HFV) can infect and replicate in HFV-susceptible cells.Coleman, S7801 and Sammy-1 strains of FFV were grown as described previously (Hatama et al., 2001). Crandell feline kidney (CRFK) cells were infected with each FFV strain, and total DNA was extracted using the Total DNA Extraction kit (Stratagene) according to the manufacturer's instructions. Preliminary experiments revealed that the extracted DNA contained a number of circular forms of unintegrated viral DNA which contained single LTRs. To construct the infectious clones, pSKY1.0 and pSKY2.0, the extracted DNA was amplified by PCR using two primer pairs, 5h agctgatgatccaagtgatgttgcttccc 3h (nt 10239-10267 in the FUV genome ; accession no. Y08851) and 5h cgactcatcctgagttgcatgttgacata 3h (nt 6395-6423), and 5h ggaatggaatgctcacaaacaactacaga 3h (nt 6357-6385) and 5h ctagggaccttaccttactgaggaaggat 3h (nt 1415-1443). Amplified DNAs were cloned into pCR2.1 (Invitrogen) to give two clones designated as 5hLTR-gag-pol (pSKY1.0) and env-bel-3hLTR (pSKY2.0). To construct the fulllength Coleman clone, pSKY3.0, the SalI and SpeI doubledigested fragment of pSKY2.0 was inserted into pSKY1.0 after digestion of the plasmid with the same enzymes. A similar procedure was used to construct the full-length S7801 clone, pSKY5.0. The DNA sequences of the FFV clones, pSKY3.0 (accession no. AB052796) and pSKY5.0 (accession no. AB052797) were determined using a DSQ-2000L DNA sequencer (Shimazu Co.). The Coleman and S7801 clones were 11 694 and 11 660 bp in length. Comparisons of the putative Gag, Pol, Env, Bel I and Bel II amino acid sequences b...

One report has shown that Nef molecules expressed by Abstract We studied human immunodeficieney virus type 1 (HIV-1) Nef protein biochemically and histologically. HIV-1 bacterial and eukaryotic systems form oligomers [11], but Nef, derived from baculosystem and from cells infected with there is no information about the oligomerization of Nef in HIV-I, formed homomeric monomers, dimers, trimers, and HIV-l-infected T cells. To clarify the mechanism of Nef-defurther polymers. These oligomers were non-covalently assopendent cell killing, we studied the biochemical and histologiciated. In cells infected with HIV-1, Nefmolecules were clustered cal properties of Nef. In this report we show that the Nef at the cell surface as well as cytoplasm. Our previous results have molecules form oligomers and cluster on the surface of indicated that the Nef on the surface of cells infected with HIV-1 HIV-1-infected CD4+ cells. is cytotoxic against uninfected CD4+ T cells. Thus, it is very likely that the HIV-l-medlated cytotoxic reaction is due, at least in part, to the clustered localization of oligomeric Nef on the cell 2. Materials and methods surface. Cells and antibodies

Although acute infection of feline foamy virus (FeFV) is normally highly cytopathogenic in Crandell feline kidney (CRFK) cells, a noncytopathic persistent infection was established in the cells after cocultivation of the initially infected cells with uninfected cells four times. To investigate reactivation of persistent infection, CRFK cells chronically infected with FeFV were treated with trichostatin A (TA), a histone deacetylase inhibitor. TA induced higher FeFV production from the Coleman strain carrier culture and also induced marked syncytium formation. In contrast, human foamy virus, which contains less homologous long terminal repeat (LTR) and putative internal promoter (IP) sequences, persistently infecting baby hamster kidney cells was not reactivated by TA. The Sammy-1 strain of FeFV, from which a part of the U3 region in the LTR is naturally deleted, showed less reactivation. The Coleman LTR promoter-based beta-Gal-expressing plasmid was activated in the persistently Coleman-infected cells in the presence of TA, whereas the Sammy-1 LTR was not activated. Furthermore, the amounts of Gag protein expressed did not change in the presence or absence of TA. Because the putative IP region was very similar between the two strains, the initiation by TA is relatively specific for LTR sequences, and, therefore, histone deacetylation is at least in part responsible for reactivation of FeFV from carrier cell culture.

No abstract