Isolation and sequencing of infectious clones of feline foamy virus and a human/feline foamy virus Env chimera

Abstract

Full-lengthThe genomic DNA of feline foamy virus (FFV) contains structural genes designated gag, pol and env, as well as the auxiliary gene bel (Helps & Harbour, 1997). These genes are located between two long terminal repeats (LTRs). Although this type of genome organization is common for foamy viruses (FVs) from several species of mammals, there are remarkable dissimilarities between FVs and other retroviruses in their mode of replication (Yu et al., 1996). For example, interactions between group-specific antigen (Gag) and envelope protein (Env) are essential for the assembly and budding of infectious FV particles (Pietschmann et al., 1999), whereas the Gag protein alone is sufficient to allow budding in cells infected with retroviruses other than FVs (Linial, 1999). Reports indicate that it is difficult to produce high titre pseudotyped FV bearing Author for correspondence : Yoichi Fujii.Fax j81 52 836 3430. e-mail fatfuji!hotmail.com glycoproteins from murine leukaemia virus Env or vesicular stomatitis virus G proteins (Lindemann et al., 1997 ;Hill et al., 1999). These observations indicate that the interaction between FV Gag and Env of different species of origin may be of interest when evaluating FVs as vector candidates for gene transfer. We report the isolation and sequencing of FFV clones SKY3.0 and SKY5.0. Furthermore, we show that a chimeric FFV clone (HFFV) bearing Env and a part of the trans-activator (Tas) from human foamy virus (HFV) can infect and replicate in HFV-susceptible cells.Coleman, S7801 and Sammy-1 strains of FFV were grown as described previously (Hatama et al., 2001). Crandell feline kidney (CRFK) cells were infected with each FFV strain, and total DNA was extracted using the Total DNA Extraction kit (Stratagene) according to the manufacturer's instructions. Preliminary experiments revealed that the extracted DNA contained a number of circular forms of unintegrated viral DNA which contained single LTRs. To construct the infectious clones, pSKY1.0 and pSKY2.0, the extracted DNA was amplified by PCR using two primer pairs, 5h agctgatgatccaagtgatgttgcttccc 3h (nt 10239-10267 in the FUV genome ; accession no. Y08851) and 5h cgactcatcctgagttgcatgttgacata 3h (nt 6395-6423), and 5h ggaatggaatgctcacaaacaactacaga 3h (nt 6357-6385) and 5h ctagggaccttaccttactgaggaaggat 3h (nt 1415-1443). Amplified DNAs were cloned into pCR2.1 (Invitrogen) to give two clones designated as 5hLTR-gag-pol (pSKY1.0) and env-bel-3hLTR (pSKY2.0). To construct the fulllength Coleman clone, pSKY3.0, the SalI and SpeI doubledigested fragment of pSKY2.0 was inserted into pSKY1.0 after digestion of the plasmid with the same enzymes. A similar procedure was used to construct the full-length S7801 clone, pSKY5.0. The DNA sequences of the FFV clones, pSKY3.0 (accession no. AB052796) and pSKY5.0 (accession no. AB052797) were determined using a DSQ-2000L DNA sequencer (Shimazu Co.). The Coleman and S7801 clones were 11 694 and 11 660 bp in length. Comparisons of the putative Gag, Pol, Env, Bel I and Bel II amino acid sequences b...

A new indicator cell line established to monitor bovine foamy virus infection

“…the Spumaretrovirinae subfamily of the Retroviridae and have been isolated from many mammalian species including human, non-human primates (chimpanzee, baboon), bovine, equine and feline species [1,4,6,15,16,25] .…”

Feline Foamy Virus-Based Vectors: Advantages of an Authentic Animal Model

“…Although there are also public concerns regarding feline experimentation, cats are more easily accessible for statistically significant FFV vector studies. Experimental infections of cats with molecularly cloned and/or engineered FFV genomes and vectors have been previously described by us and others [4,21,22,23]. …”

“…Several RC FFV genomes from both known FFV serotypes have been constructed [23,26,27]. Importantly, infection with either serotype does not appear to induce cross-neutralizing antibodies, a feature highly advantageous for repeated FFV vector applications.…”

Preparation of BFV Gag antiserum and preliminary study on cellular distribution of BFV

“…Foamy viruses (FVs) are the only genus of the Spumaretrovirinae subfamily. Besides a variety of primate species such as chimpanzees and baboons, FVs have also been isolated from other hosts including bovine, equine and feline species [1,4,5,9,19] .…”