No abstract

Teleostean fins when partially amputated suffer a regenerative process called epimorphic regeneration, characterized by the following stages: healing, based on the formation of a multistratified epidermal layer, the formation of a mass of pluripotent cells known as blastema, the differentiation of these cells, the synthesis and disposition of the extracellular matrix, morphological growth and restoration. The epidermis has a fundamental role in the regenerative process of fish fins, as the healing time of this structure leads it to a faster regenerative process and it also works as a defense against the external environment. In this sense, due to the fast regeneration shown by the epidermis, the aim of this paper is to study the histology of the regenerative dynamics of the carp fin tail (Cyprinus carpio), under the light and transmission electron microscope. Epidermic regeneration begins right in the first hours after the fin amputation and it continues throughout the regenerative process. After 24 hours, an apical epidermal cap is established. Cytoplasmatic prolongations and intercellular junctions are observed and the cells of the basal layer of the epidermis change from the cubic form to the cylindrical, due to the development of the cytoplasmatic organelles responsible for the synthesis of the basal membrane, lost after amputation. These results show the importance of histological studies in regenerative processes. We believe that the association of molecular biology with histological studies can throw further light onto these regenerative dynamics.Keywords: regeneration, fin, fish, epidermis, transmission electron microscopy.Estudo histológico da dinâmica da regeneração da epiderme da nadadeira caudal da carpa (Cyprinus carpio Linnaeus, 1758) ResumoAs nadadeiras dos teleósteos, quando parcialmente amputadas, sofrem um processo de regeneração chamado de regeneração epimórfica, caracterizado pelas seguintes fases: cicatrização, a partir da formação de uma capa epidermal multiestratificada, formação de uma massa de células mesenquimais multipotentes chamada blastema, diferenciação dessas células, síntese e deposição de matriz extracelular, crescimento e restauração morfológica. A epiderme tem papel fundamental no processo regenerativo das nadadeiras dos peixes, uma vez que a velocidade de cicatrização dessa estrutura leva a um processo regenerativo mais rápido e, também, age como uma defesa contra o ambiente externo. Assim, devido à rápida regeneração que a epiderme apresenta, tivemos como objetivo, neste trabalho, estudar a histologia da dinâmica regenerativa da epiderme das nadadeiras caudais da carpa (Cyprinus carpio) ao microscópio de luz e eletrônico de transmissão. A regeneração da epiderme tem início já nas primeiras horas após a amputação das nadadeiras e continua durante todo o processo regenerativo. Após 24 horas, uma capa epidermal apical é estabelecida.Prolongamentos citoplasmáticos e junções intercelulares são observados e as células da camada basal da epiderme passam da forma cúbica para...

The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales) strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae), against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS) and non-autoclaved (NAS) soil from typical citrus orchards in the State of São Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 10 10 for AS and 2.52 x 10 10 for NAS. The lethal concentration (LC50), expressed as conidia concentration, was 8.44 x 10 9 conidia/g of soil (S) for AS and 12.23 x 10 9 conidia/g of soil for NAS.

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

The physiological role of high lipid content in endometrial cells during pregnancy has not been well established. In the present work we used histochemical techniques to analyze the total lipids and phospholipid containing choline (PCC) in the mouse uterine glandular and luminal epithelia during preimplantation stage. Sudan black histochemistry showed the highest intensity during the second day of pregnancy in both the basal and apical portions of luminal epithelium. Peaks of PCC staining were seen both in the luminal and glandular epithelia at the second and fifth days of pregnancy. Changes in localization and in the amount of lipid in the uterine epithelia suggest high mobility and metabolic rates of this substance, which may be related to morphological and/or functional changes occurring at the same time in the pregnant uterus. The increase and depletion timing of PCC content in the uterine epithelia during preimplantation stage, when uterine prostaglandin is also oscillating, suggest a possible involvement of PCC in prostaglandin biosynthesis. Therefore, the fate of lipid droplets found in the uterine epithelia may be related to critical changes of the pregnant endometrium, rather than the nourishment of developing embryos alone.