Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

Abstract

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Pathogenicity of Beauveria bassiana and Metarhizium anisopliae to Anastrepha fraterculus (Diptera: Tephritidae) and Effects on Adult Longevity

“…The absence of infected adults from pupal inoculations may be due to the rapid kill during the pupal phase due to toxic metabolites secreted by fungi soon after pupal cuticle penetration (Sinha et al, 2016). The sublethal effect of fungi on adult insects from inoculations of immature stages has been reported previously (Bechara et al, 2011;Bissoli, Correia, & Barbosa, 2014). However, with the present study, we observed 20.0% mortality on the first day after the adult emergence, reaching 50.0% mortality by the sixth day, and total mortality by the 12th day.…”

Synergism between Hydramethylnon and Metarhizium anisopliae and Their Influence on the Gut Microbiome of Blattella germanica (L.)

“…Our study shows that the M. anisopliae infection rate with per os infection is lower than that with topical dorsal infection ( Figure 1 A). For the entomopathogenic fungi, the infection cycle can usually be divided into five stages: adhesion to the cuticle, germination, penetration through the exoskeleton, host tissue colonization and sporulation [ 51 , 52 , 53 ]. M. anisopliae could produce some specific degrading enzymes to penetrate the cuticle of the insect and adapt to the highly permeable environment of the host’s hemolymph based on a MOS1 osmosensor to combat the insect immune system in long-term evolution [ 54 , 55 , 56 ].…”

Alternative substrates for conidiogenesis of the entomopathogenic fungus Beauveria bassiana (Bals) Vuillemin (Deuteromycotina: Hyphomycetes)

“…The extracellular proteases produced by B. bassiana play a crucial role in hydrolysis of the cuticle, which is required for penetration of the fungus throughout the exoskeleton (Bidochka and Khachatourians, 1990). Once in the hemolymph, the fungus may produce toxic metabolites capable of causing paralysis (Shelton et al, 1998), acting on hemocytes (Mazet et al, 1994) and destroying the normal physiological balance of the host system (Sharma et al, 1994;Bechara et al, 2011).…”