Acid-sensing is associated with both nociception and taste transduction. Stimulation of sensory neurons by acid is of particular interest, because acidosis accompanies many painful inflammatory and ischaemic conditions. The pain caused by acids is thought to be mediated by H+-gated cation channels present in sensory neurons. We have now cloned a H+-gated channel (ASIC, for acid-sensing ionic channel) that belongs to the amiloride-sensitive Na+ channel/degenerin family of ion channels. Heterologous expression of ASIC induces an amiloride-sensitive cation (Na+ > Ca2+ > K+) channel which is transiently activated by rapid extracellular acidification. The biophysical and pharmacological properties of the ASIC channel closely match the H+-gated cation channel described in sensory neurons. ASIC is expressed in dorsal root ganglia and is also distributed widely throughout the brain. ASIC appears to be the simplest of ligand-gated channels.

Cystic fibrosis is associated with a defect in epithelial chloride ion transport which is caused by mutations in a membrane protein called CFTR (cystic fibrosis transmembrane conductance regulator). Heterologous expression of CFTR produces cyclicAMP-sensitive Cl(-)-channel activity. Deletion of phenylalanine at amino-acid position 508 in CFTR (delta F508 CFTR) is the most common mutation in cystic fibrosis. It has been proposed that this mutation prevents glycoprotein maturation and its transport to its normal cellular location. We have expressed both CFTR and delta F508 CFTR in Vero cells using recombinant vaccinia virus. Although far less delta F508 CFTR reached the plasma membrane than normal CFTR, sufficient delta F508 CFTR was expressed at the plasma membrane to permit functional analysis. delta F508 CFTR expression induced a reduced activity of the cAMP-activated Cl- channel, with conductance, anion selectivity and open-time kinetics similar to those of CFTR, but with much greater closed times, resulting in a large decrease of open probability. The delta F508 mutation thus seems to have two major consequences, an abnormal translocation of the CFTR protein which limits membrane insertion, and an abnormal function in mediating Cl- transport.

We have cloned and expressed a novel proton-gated Na ؉ channel subunit that is specific for sensory neurons. In COS cells, it forms a Na ؉ channel that responds to a drop of the extracellular pH with both a rapidly inactivating and a sustained Na ؉ current. This biphasic kinetic closely resembles that of the H ؉ -gated current described in sensory neurons of dorsal root ganglia (1). Both the abundance of this novel H؉ -gated Na ؉ channel subunit in sensory neurons and the kinetics of the channel suggest that it is part of the channel complex responsible for the sustained H ؉ -activated cation current in sensory neurons that is thought to be important for the prolonged perception of pain that accompanies tissue acidosis (1, 2).Many painful inflammatory and ischemic conditions are accompanied by a decrease of the extracellular pH (2, 3). H ϩ -gated cation channels are present in sensory neurons (1, 4 -6), and it is likely that those acid-sensing ion channels are the link between tissue acidosis and pain. We recently cloned a rapidly inactivating H ϩ -gated cation channel ASIC 1 (7) (acid-sensing ion channel). Fast inactivating H ϩ -gated cation currents were described in neurons of the central nervous system (6,8,9) and in sensory neurons (4 -6), tissues where ASIC is well expressed (7). However, rapidly inactivating H ϩ -gated cation channels cannot account solely for the prolonged sensation of pain that accompanies tissue acidosis. Sensory neurons respond to a drop in pH with a rapidly inactivating followed by a sustained current, which is thought to mediate the non-adaptive pain caused by acids (1). Here we describe the cloning of a H ϩ -gated cation channel specific for sensory neurons that has both a rapidly inactivating and a sustained component. MATERIALS AND METHODSCloning of DRASIC-We used an anchored PCR approach to identify the sequences upstream and downstream of the expressed sequence tag (W62694). An double stranded adapter (anchor) was prepared by annealing the oligonucleotides GATTTAGGTGACACTATAGAATCGA-GGTCGACGGTATCCAGTCGACGAATTC and PO 4 -GAATTCGTCGA-CTG-NH 2 . The shorter oligonucleotide was protected with a 3Ј NH 2 group to avoid extension during the PCR reaction. This adapter was ligated to double stranded rat brain cDNA resulting in a cDNA with known sequences (the anchor) on both extremities. The so prepared anchored cDNA was used to amplify the 5Ј and the 3Ј end of the coding sequence by PCR. This was done using either the primer GATTTAG-GTGACACTATAGAA or TAGAATCGAGGTCGACGGTATC, which are identical to parts of the longer of the two adapter oligonucleotides together with either the sense primer (CACTACACGCTATGCCAAGG, for amplification of the 3Ј end) or the antisense primer (CCCAG-CAACTCCGACACTTC, for amplification of the 5Ј end) complementary to the expressed sequence tag (W62694). The PCR products were subcloned into Bluescript, and five clones each for the 5Ј PCR and for the 3Ј PCR were sequenced. The anchored PCR allowed us to identify the sequences upstream of the first ATG codon and down...

Acid sensing is associated with nociception, taste transduction, and perception of extracellular pH fluctuations in the brain. Acid sensing is carried out by the simplest class of ligand-gated channels, the family of H ؉ -gated Na ؉ channels. These channels have recently been cloned and belong to the acid-sensitive ion channel (ASIC) family. Toxins from animal venoms have been essential for studies of voltage-sensitive and ligandgated ion channels. This paper describes a novel 40-amino acid toxin from tarantula venom, which potently blocks (IC 50 ‫؍‬ 0.9 nM) a particular subclass of ASIC channels that are highly expressed in both central nervous system neurons and sensory neurons from dorsal root ganglia. This channel type has properties identical to those described for the homomultimeric assembly of ASIC1a. Homomultimeric assemblies of other members of the ASIC family and heteromultimeric assemblies of ASIC1a with other ASIC subunits are insensitive to the toxin. The new toxin is the first high affinity and highly selective pharmacological agent for this novel class of ionic channels. It will be important for future studies of their physiological and physio-pathological roles.Proton-gated Na ϩ -permeable channels are the simplest form of ligand-gated channels. They are present in many neuronal cell types throughout the central nervous system (1-5), suggesting an important function of these channels in signal transduction associated with local pH variations during normal neuronal activity. These channels might also play an important role in pathological situations such as brain ischemia or epilepsy, which produce significant extracellular acidification. They are also present in nociceptive neurons (1-3, 5, 6) and are thought to be responsible for the sensation of pain that accompanies tissue acidosis in muscle and cardiac ischemia (7,8), corneal injury (9), and inflammation and local infection (10, 11). It is only very recently that the first proton-gated channel, acid-sensitive ion channel (ASIC) 1 was cloned (12). The ASICs belong to a superfamily that includes amiloride-sensitive epithelial Na ϩ channels (13, 14), the FMRFamide-gated Na ϩ channel (15), and the nematode degenerins (DEGs), which probably correspond to mechano-sensitive Na ϩ -permeable channels (16). Several ASIC subunits have now been described: ASIC1a (12), ASIC1b (17), ASIC2a (18 -21), ASIC2b (22), and ASIC3 (23-25). The different subunits produce channels with different kinetics, external pH sensitivities, and tissue distribution. They can form functional homomultimers as well as heteromultimers (21,22,26). ASIC1a and ASIC1b both mediate rapidly inactivating currents following rapid and modest acidification of the external pH. However, although ASIC1a is present in both brain and afferent sensory neurons, its splice variant ASIC1b is found only in sensory neurons (17). ASIC2a forms an active H ϩ -gated channel and is abundant in the brain but essentially absent in sensory neurons, whereas its splice variant ASIC2b is present in both brain an...

The peptide Phe-Met-Arg-Phe-NH2 (FMRFamide) and structurally related peptides are present both in invertebrate and vertebrate nervous systems. Although they constitute a major class of invertebrate peptide neurotransmitters, the molecular structure of their receptors has not yet been identified. In neurons of the snail Helix aspersa, as well as in Aplysia bursting and motor neurons, FMRFamide induces a fast excitatory depolarizing response due to direct activation of an amiloride-sensitive Na+ channel. We have now isolated a complementary DNA from Helix nervous tissue; when expressed in Xenopus oocytes, it encodes an FMRFamide-activated Na+ channel (FaNaCh) that can be blocked by amiloride. The corresponding protein shares a very low sequence identity with the previously cloned epithelial Na+ channel subunits and Caenorhabditis elegans degenerins, but it displays the same overall structural organization. To our knowledge, this is the first characterization of a peptide-gated ionotropic receptor.

We have isolated a cDNA for a novel human amiloride-sensitive Na+ channel isoform (called delta) which is expressed mainly in brain, pancreas, testis, and ovary. When expressed in Xenopus oocytes, it generates an amiloride-sensitive Na+ channel with biophysical and pharmacological properties distinct from those of the epithelial Na+ channel, a multimeric assembly of alpha, beta, and gamma subunits. The Na+ current produced by the new delta isoform is increased by two orders of magnitude after coexpression of the beta and gamma subunit of the epithelial Na+ channel showing that delta can associate with other subunits and is part of a novel multisubunit ion channel.

Mutations of the degenerins (deg-1, mec-4, mec-10) are the major known causes of hereditary neurodegeneration in the nematode Caenorhabditis elegans. We cloned a neuronal degenerin (MDEG) from human and rat brain. MDEG is an amiloride-sensitive cation channel permeable for Na+, K+, and Li+. This channel is activated by the same mutations which cause neurodegeneration in C. elegans. Like the hyperactive C. elegans degenerin mutants, constitutively active mutants of MDEG cause cell death, suggesting that gain of function of this novel neuronal ion channel might be involved in human forms of neurodegeneration.

Acid-sensing ion channels (ASICs) are cationic channels activated by extracellular protons. They are expressed in sensory neurons, where they are thought to be involved in pain perception associated with tissue acidosis. They are also expressed in brain. A number of brain regions, like the hippocampus, contain large amounts of chelatable vesicular Zn 2؉ . This paper shows that Zn 2؉ potentiates the acid activation of homomeric and heteromeric ASIC2a-containing channels (i.e. ASIC2a, ASIC1a؉2a, ASIC2a؉3), but not of homomeric ASIC1a and ASIC3. The EC 50 for Zn 2؉ potentiation is 120 and 111 M for the ASIC2a and ASIC1a؉2a current, respectively. Zn 2؉ shifts the pH dependence of activation of the ASIC1a؉2a current from a pH 0.5 of 5.5 to 6.0. Systematic mutagenesis of the 10 extracellular histidines of ASIC2a leads to the identification of two residues (His-162 and His-339) that are essential for the Zn 2؉ potentiating effect. Mutation of another histidine residue, His-72, abolishes the pH sensitivity of ASIC2a. This residue, which is located just after the first transmembrane domain, seems to be an essential component of the extracellular pH sensor of ASIC2a.