Acid-sensing is associated with both nociception and taste transduction. Stimulation of sensory neurons by acid is of particular interest, because acidosis accompanies many painful inflammatory and ischaemic conditions. The pain caused by acids is thought to be mediated by H+-gated cation channels present in sensory neurons. We have now cloned a H+-gated channel (ASIC, for acid-sensing ionic channel) that belongs to the amiloride-sensitive Na+ channel/degenerin family of ion channels. Heterologous expression of ASIC induces an amiloride-sensitive cation (Na+ > Ca2+ > K+) channel which is transiently activated by rapid extracellular acidification. The biophysical and pharmacological properties of the ASIC channel closely match the H+-gated cation channel described in sensory neurons. ASIC is expressed in dorsal root ganglia and is also distributed widely throughout the brain. ASIC appears to be the simplest of ligand-gated channels.

MDEG1 is a cation channel expressed in brain that belongs to the degenerin/epithelial Na؉ channel superfamily. It is activated by the same mutations which cause neurodegeneration in Caenorhabditis elegans if present in the degenerins DEG-1, MEC-4, and MEC-10. MDEG1 shares 67% sequence identity with the recently cloned proton-gated cation channel ASIC (acid sensing ion channel), a new member of the family which is present in brain and in sensory neurons. We have now identified MDEG1 as a proton-gated channel with properties different from those of ASIC. MDEG1 requires more acidic pH values for activation and has slower inactivation kinetics. In addition, we have cloned from mouse and rat brain a splice variant form of the MDEG1 channel which differs in the first 236 amino acids, including the first transmembrane region. This new membrane protein, which has been called MDEG2, is expressed in both brain and sensory neurons. MDEG2 is activated neither by mutations that bring neurodegeneration once introduced in C. elegans degenerins nor by low pH. However, it can associate both with MDEG1 and another recently cloned H ؉ -activated channel DRASIC to form heteropolymers which display different kinetics, pH dependences, and ion selectivities. Of particular interest is the subunit combination specific for sensory neurons, MDEG2/DRASIC. In response to a drop in pH, it gives rise to a biphasic current with a sustained current which discriminates poorly between Na ؉ and K ؉ , like the native H ؉ -gated current recorded in dorsal root ganglion cells. This sustained current is thought to be required for the tonic sensation of pain caused by acids.

We have cloned and expressed a novel proton-gated Na ؉ channel subunit that is specific for sensory neurons. In COS cells, it forms a Na ؉ channel that responds to a drop of the extracellular pH with both a rapidly inactivating and a sustained Na ؉ current. This biphasic kinetic closely resembles that of the H ؉ -gated current described in sensory neurons of dorsal root ganglia (1). Both the abundance of this novel H؉ -gated Na ؉ channel subunit in sensory neurons and the kinetics of the channel suggest that it is part of the channel complex responsible for the sustained H ؉ -activated cation current in sensory neurons that is thought to be important for the prolonged perception of pain that accompanies tissue acidosis (1, 2).Many painful inflammatory and ischemic conditions are accompanied by a decrease of the extracellular pH (2, 3). H ϩ -gated cation channels are present in sensory neurons (1, 4 -6), and it is likely that those acid-sensing ion channels are the link between tissue acidosis and pain. We recently cloned a rapidly inactivating H ϩ -gated cation channel ASIC 1 (7) (acid-sensing ion channel). Fast inactivating H ϩ -gated cation currents were described in neurons of the central nervous system (6,8,9) and in sensory neurons (4 -6), tissues where ASIC is well expressed (7). However, rapidly inactivating H ϩ -gated cation channels cannot account solely for the prolonged sensation of pain that accompanies tissue acidosis. Sensory neurons respond to a drop in pH with a rapidly inactivating followed by a sustained current, which is thought to mediate the non-adaptive pain caused by acids (1). Here we describe the cloning of a H ϩ -gated cation channel specific for sensory neurons that has both a rapidly inactivating and a sustained component. MATERIALS AND METHODSCloning of DRASIC-We used an anchored PCR approach to identify the sequences upstream and downstream of the expressed sequence tag (W62694). An double stranded adapter (anchor) was prepared by annealing the oligonucleotides GATTTAGGTGACACTATAGAATCGA-GGTCGACGGTATCCAGTCGACGAATTC and PO 4 -GAATTCGTCGA-CTG-NH 2 . The shorter oligonucleotide was protected with a 3Ј NH 2 group to avoid extension during the PCR reaction. This adapter was ligated to double stranded rat brain cDNA resulting in a cDNA with known sequences (the anchor) on both extremities. The so prepared anchored cDNA was used to amplify the 5Ј and the 3Ј end of the coding sequence by PCR. This was done using either the primer GATTTAG-GTGACACTATAGAA or TAGAATCGAGGTCGACGGTATC, which are identical to parts of the longer of the two adapter oligonucleotides together with either the sense primer (CACTACACGCTATGCCAAGG, for amplification of the 3Ј end) or the antisense primer (CCCAG-CAACTCCGACACTTC, for amplification of the 5Ј end) complementary to the expressed sequence tag (W62694). The PCR products were subcloned into Bluescript, and five clones each for the 5Ј PCR and for the 3Ј PCR were sequenced. The anchored PCR allowed us to identify the sequences upstream of the first ATG codon and down...

We have isolated a cDNA for a novel human amiloride-sensitive Na+ channel isoform (called delta) which is expressed mainly in brain, pancreas, testis, and ovary. When expressed in Xenopus oocytes, it generates an amiloride-sensitive Na+ channel with biophysical and pharmacological properties distinct from those of the epithelial Na+ channel, a multimeric assembly of alpha, beta, and gamma subunits. The Na+ current produced by the new delta isoform is increased by two orders of magnitude after coexpression of the beta and gamma subunit of the epithelial Na+ channel showing that delta can associate with other subunits and is part of a novel multisubunit ion channel.

Proton-gated cation channels are acid sensors that are present in both sensory neurons and in neurons of the central nervous system. One of these acid-sensing ion channels (ASIC) has been recently cloned. This paper shows that ASIC and the mammalian degenerin MDEG, which are colocalized in the same brain regions, can directly associate with each other. Immunoprecipitation of MDEG causes coprecipitation of ASIC. Moreover, coexpression of ASIC and MDEG subunits in Xenopus oocytes generates an amiloride-sensitive H ؉ -gated Na ؉ channel with novel properties (different kinetics, ionic selectivity, and pH sensitivity). In addition, coexpression of MDEG with mutants of the ASIC subunit can create constitutively active channels that become completely nonselective for Na ؉ versus K ؉ and H ؉ -gated channels that have a drastically altered pH sensitivity compared with MDEG. These data clearly show that ASIC and MDEG can form heteromultimeric assemblies with novel properties. Heteromultimeric assembly is probably used for creating a diversity of H ؉ -gated cation channels acting as neuronal acid sensors in different pH ranges.H ϩ -gated cation channels are ligand-gated ion channels activated by the simplest possible ligand, the proton. In nociceptive neurons those channels are thought to be responsible for the sensation of pain that accompanies tissue acidosis (1-3), particularly during inflammation and ischemic conditions. H ϩ -gated cation channels are also present in neurons of the central nervous system (2), where their physiological role remains to be established. We have recently cloned a proton-gated cation channel (ASIC, acid sensing ion channel 1) (4). The closest structural homologue of ASIC is MDEG (5, 6). MDEG is a mammalian degenerin. Upon the same mutations that in Caenorhabditis elegans degenerins induce degeneration of specific neurons (7,8), MDEG can also acquire constitutive Na ϩ channel activity that becomes toxic for the cells in which it is expressed (5). In addition, native MDEG also behaves as a H ϩ -gated Na ϩ channel. The variety of H ϩ -gated cation channels with different ion selectivities, pH dependencies, and kinetics described in sensory neurons (1, 9, 10), as well as in neurons of the central nervous system (2), suggests that ASIC and MDEG are probably only the first two members of this novel ion channel family and that other genes for new H ϩ -activated Na ϩ channels remain to be discovered. However, the existence of different genes is probably only one of the ways used to create a diversity of H ϩ -gated cation channels. Many other types of ion channels are known to form heteromultimers of structurally related subunits, resulting in the assembly of channels with novel properties (11). Furthermore, other structural homologues of the ASIC and MDEG channels, such as the epithelial amiloride-sensitive Na ϩ channel (12-18) and the degenerins of the nematode C. elegans, which are believed to be mechanosensitive channels (19 -21), require heteromultimeric subunit assembly for their function. All...

Polyclonal antibodies have been raised against the alpha, beta and gamma subunits of the amiloride-sensitive Na+ channel. The three subunits were detected by immunohistochemistry at the apical membrane of epithelial cells from the distal colon, the lung and the distal segments of the kidney tubules. No significant labelling was detected in lung alveoli, suggesting that it is not a major site of expression of the Na+ channel. Effects of a low Na+ diet or of dexamethasone treatment were measured at the mRNA level and at the protein level by immunohistochemistry. In the colon, steroids controlled Na+ channel activity via the stimulation of the transcription of beta and gamma subunits. The alpha mRNA was constitutively expressed. However, while neither alpha, beta nor gamma proteins were detected in the colon of control animals, they were all detected in the colon of steroid-treated animals. In the lung, Na+ channel expression was regulated by glucocorticoids the circulating level of which was sufficiently high to induce a maximal expression of the three subunits, even in control animals. Adrenalectomy drastically reduced expression of the three subunits. A surprising finding was the apparent absence of steroid effects on alpha, beta and gamma subunit expression in the kidney. Neither the expression of the mRNAs nor the expression of the proteins were significantly altered by aldosterone or by dexamethasone. These results could be due to mixed gluco- and mineralocorticoid regulations in different segments of the kidney tubule, but their interpretation also requires regulations that are apparently not found in the lung or colon.

Ablation of the cellular prion protein PrPC leads to a chronic demyelinating polyneuropathy (CDP) affecting Schwann cells. Neuron-restricted PrPC expression prevents the disease1, suggesting that it acts in trans through an unidentified Schwann cell receptor. We found that the cAMP concentration in PrPC-deficient sciatic nerves is reduced, suggesting the involvement of a G protein-coupled receptor (GPCR). The amino-terminal “flexible tail” (FT, residues 23-120) of PrPC triggered a concentration-dependent cAMP increase in primary Schwann cells, in the Schwann-cell line SW10, and in Hek293T cells overexpressing the GPCR Gpr126/Adgrg6. In contrast, naïve HEK293T cells and HEK293T cells expressing several other GPCRs did not react to the FT, and ablation of Gpr126 from SW10 cells abolished the FT-induced cAMP response. The FT contains a polycationic cluster (KKRPKPG) similar to the GPRGKPG motif of the Gpr126 agonist, type-IV collagen2 (Col4). A KKRPKPG-containing PrPC-derived peptide (FT23-50) sufficed to induce a Gpr126-dependent cAMP response in cells and mice, and improved myelination in hypomorphic Gpr126 zebrafish mutants. Substitution of the cationic residues with alanines abolished the biological activity of both FT23-50 and the respective Col4 peptide. We conclude that PrPC promotes myelin homeostasis through FT-mediated Gpr126 agonism. Besides clarifying the physiological role of PrPC, these observations are relevant to the pathogenesis of demyelinating polyneuropathies, common debilitating diseases with limited therapeutic options.

The Wnt/β-catenin signaling pathbway controls many important biological processes. R-Spondin (RSPO) proteins are a family of secreted molecules that strongly potentiate Wnt/β-catenin signaling, however, the molecular mechanism of RSPO action is not yet fully understood. We performed an unbiased siRNA screen to identify molecules specifically required for RSPO, but not Wnt, induced β-catenin signaling. From this screen, we identified LGR4, then an orphan G protein-coupled receptor (GPCR), as the cognate receptor of RSPO. Depletion of LGR4 completely abolished RSPO-induced β-catenin signaling. The loss of LGR4 could be compensated by overexpression of LGR5, suggesting that LGR4 and LGR5 are functional homologs. We further demonstrated that RSPO binds to the extracellular domain of LGR4 and LGR5, and that overexpression of LGR4 strongly sensitizes cells to RSPO-activated β-catenin signaling. Supporting the physiological significance of RSPO-LGR4 interaction, Lgr4−/− crypt cultures failed to grow in RSPO-containing intestinal crypt culture medium. No coupling between LGR4 and heterotrimeric G proteins could be detected in RSPO-treated cells, suggesting that LGR4 mediates RSPO signaling through a novel mechanism. Identification of LGR4 and its relative LGR5, an adult stem cell marker, as the receptors of RSPO will facilitate the further characterization of these receptor/ligand pairs in regenerative medicine applications.