Acid-sensing is associated with both nociception and taste transduction. Stimulation of sensory neurons by acid is of particular interest, because acidosis accompanies many painful inflammatory and ischaemic conditions. The pain caused by acids is thought to be mediated by H+-gated cation channels present in sensory neurons. We have now cloned a H+-gated channel (ASIC, for acid-sensing ionic channel) that belongs to the amiloride-sensitive Na+ channel/degenerin family of ion channels. Heterologous expression of ASIC induces an amiloride-sensitive cation (Na+ > Ca2+ > K+) channel which is transiently activated by rapid extracellular acidification. The biophysical and pharmacological properties of the ASIC channel closely match the H+-gated cation channel described in sensory neurons. ASIC is expressed in dorsal root ganglia and is also distributed widely throughout the brain. ASIC appears to be the simplest of ligand-gated channels.
MDEG1 is a cation channel expressed in brain that belongs to the degenerin/epithelial Na؉ channel superfamily. It is activated by the same mutations which cause neurodegeneration in Caenorhabditis elegans if present in the degenerins DEG-1, MEC-4, and MEC-10. MDEG1 shares 67% sequence identity with the recently cloned proton-gated cation channel ASIC (acid sensing ion channel), a new member of the family which is present in brain and in sensory neurons. We have now identified MDEG1 as a proton-gated channel with properties different from those of ASIC. MDEG1 requires more acidic pH values for activation and has slower inactivation kinetics. In addition, we have cloned from mouse and rat brain a splice variant form of the MDEG1 channel which differs in the first 236 amino acids, including the first transmembrane region. This new membrane protein, which has been called MDEG2, is expressed in both brain and sensory neurons. MDEG2 is activated neither by mutations that bring neurodegeneration once introduced in C. elegans degenerins nor by low pH. However, it can associate both with MDEG1 and another recently cloned H ؉ -activated channel DRASIC to form heteropolymers which display different kinetics, pH dependences, and ion selectivities. Of particular interest is the subunit combination specific for sensory neurons, MDEG2/DRASIC. In response to a drop in pH, it gives rise to a biphasic current with a sustained current which discriminates poorly between Na ؉ and K ؉ , like the native H ؉ -gated current recorded in dorsal root ganglion cells. This sustained current is thought to be required for the tonic sensation of pain caused by acids.
We have cloned and expressed a novel proton-gated Na ؉ channel subunit that is specific for sensory neurons. In COS cells, it forms a Na ؉ channel that responds to a drop of the extracellular pH with both a rapidly inactivating and a sustained Na ؉ current. This biphasic kinetic closely resembles that of the H ؉ -gated current described in sensory neurons of dorsal root ganglia (1). Both the abundance of this novel H؉ -gated Na ؉ channel subunit in sensory neurons and the kinetics of the channel suggest that it is part of the channel complex responsible for the sustained H ؉ -activated cation current in sensory neurons that is thought to be important for the prolonged perception of pain that accompanies tissue acidosis (1, 2).Many painful inflammatory and ischemic conditions are accompanied by a decrease of the extracellular pH (2, 3). H ϩ -gated cation channels are present in sensory neurons (1, 4 -6), and it is likely that those acid-sensing ion channels are the link between tissue acidosis and pain. We recently cloned a rapidly inactivating H ϩ -gated cation channel ASIC 1 (7) (acid-sensing ion channel). Fast inactivating H ϩ -gated cation currents were described in neurons of the central nervous system (6,8,9) and in sensory neurons (4 -6), tissues where ASIC is well expressed (7). However, rapidly inactivating H ϩ -gated cation channels cannot account solely for the prolonged sensation of pain that accompanies tissue acidosis. Sensory neurons respond to a drop in pH with a rapidly inactivating followed by a sustained current, which is thought to mediate the non-adaptive pain caused by acids (1). Here we describe the cloning of a H ϩ -gated cation channel specific for sensory neurons that has both a rapidly inactivating and a sustained component. MATERIALS AND METHODSCloning of DRASIC-We used an anchored PCR approach to identify the sequences upstream and downstream of the expressed sequence tag (W62694). An double stranded adapter (anchor) was prepared by annealing the oligonucleotides GATTTAGGTGACACTATAGAATCGA-GGTCGACGGTATCCAGTCGACGAATTC and PO 4 -GAATTCGTCGA-CTG-NH 2 . The shorter oligonucleotide was protected with a 3Ј NH 2 group to avoid extension during the PCR reaction. This adapter was ligated to double stranded rat brain cDNA resulting in a cDNA with known sequences (the anchor) on both extremities. The so prepared anchored cDNA was used to amplify the 5Ј and the 3Ј end of the coding sequence by PCR. This was done using either the primer GATTTAG-GTGACACTATAGAA or TAGAATCGAGGTCGACGGTATC, which are identical to parts of the longer of the two adapter oligonucleotides together with either the sense primer (CACTACACGCTATGCCAAGG, for amplification of the 3Ј end) or the antisense primer (CCCAG-CAACTCCGACACTTC, for amplification of the 5Ј end) complementary to the expressed sequence tag (W62694). The PCR products were subcloned into Bluescript, and five clones each for the 5Ј PCR and for the 3Ј PCR were sequenced. The anchored PCR allowed us to identify the sequences upstream of the first ATG codon and down...
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.