Molecular Cloning of a Non-inactivating Proton-gated Na+ Channel Specific for Sensory Neurons

Abstract

We have cloned and expressed a novel proton-gated Na ؉ channel subunit that is specific for sensory neurons. In COS cells, it forms a Na ؉ channel that responds to a drop of the extracellular pH with both a rapidly inactivating and a sustained Na ؉ current. This biphasic kinetic closely resembles that of the H ؉ -gated current described in sensory neurons of dorsal root ganglia (1). Both the abundance of this novel H؉ -gated Na ؉ channel subunit in sensory neurons and the kinetics of the channel suggest that it is part of the channel complex responsible for the sustained H ؉ -activated cation current in sensory neurons that is thought to be important for the prolonged perception of pain that accompanies tissue acidosis (1, 2).Many painful inflammatory and ischemic conditions are accompanied by a decrease of the extracellular pH (2, 3). H ϩ -gated cation channels are present in sensory neurons (1, 4 -6), and it is likely that those acid-sensing ion channels are the link between tissue acidosis and pain. We recently cloned a rapidly inactivating H ϩ -gated cation channel ASIC 1 (7) (acid-sensing ion channel). Fast inactivating H ϩ -gated cation currents were described in neurons of the central nervous system (6,8,9) and in sensory neurons (4 -6), tissues where ASIC is well expressed (7). However, rapidly inactivating H ϩ -gated cation channels cannot account solely for the prolonged sensation of pain that accompanies tissue acidosis. Sensory neurons respond to a drop in pH with a rapidly inactivating followed by a sustained current, which is thought to mediate the non-adaptive pain caused by acids (1). Here we describe the cloning of a H ϩ -gated cation channel specific for sensory neurons that has both a rapidly inactivating and a sustained component. MATERIALS AND METHODSCloning of DRASIC-We used an anchored PCR approach to identify the sequences upstream and downstream of the expressed sequence tag (W62694). An double stranded adapter (anchor) was prepared by annealing the oligonucleotides GATTTAGGTGACACTATAGAATCGA-GGTCGACGGTATCCAGTCGACGAATTC and PO 4 -GAATTCGTCGA-CTG-NH 2 . The shorter oligonucleotide was protected with a 3Ј NH 2 group to avoid extension during the PCR reaction. This adapter was ligated to double stranded rat brain cDNA resulting in a cDNA with known sequences (the anchor) on both extremities. The so prepared anchored cDNA was used to amplify the 5Ј and the 3Ј end of the coding sequence by PCR. This was done using either the primer GATTTAG-GTGACACTATAGAA or TAGAATCGAGGTCGACGGTATC, which are identical to parts of the longer of the two adapter oligonucleotides together with either the sense primer (CACTACACGCTATGCCAAGG, for amplification of the 3Ј end) or the antisense primer (CCCAG-CAACTCCGACACTTC, for amplification of the 5Ј end) complementary to the expressed sequence tag (W62694). The PCR products were subcloned into Bluescript, and five clones each for the 5Ј PCR and for the 3Ј PCR were sequenced. The anchored PCR allowed us to identify the sequences upstream of the first ATG codon and down...

Acid-sensing ion channels (ASICs) as pharmacological targets for neurodegenerative diseases

“…However, they may associate with other subunits to form heteromeric ASICs with distinct properties [26]. ASIC3 is predominantly expressed in dorsal root ganglia [28]. Homomeric ASIC3 channels respond to pH o drops by a biphasic response with a fast desensitizing current followed by a sustained component [28,29].…”

“…ASIC3 is predominantly expressed in dorsal root ganglia [28]. Homomeric ASIC3 channels respond to pH o drops by a biphasic response with a fast desensitizing current followed by a sustained component [28,29]. These channels have a high sensitivity to protons and a pH 0.5 of 6.7 has been reported [29].…”

“…It reversibly inhibits the ASIC currents with an IC 50 of 10 -50 μM [10,13,24,28,42]. Similar to its effect on the ASIC currents, amiloride inhibits acidinduced increase of [Ca 2+ ] i and membrane depolarization [10,12,43,44].…”

“…Similar to its effect on the ASIC currents, amiloride inhibits acidinduced increase of [Ca 2+ ] i and membrane depolarization [10,12,43,44]. The sustained component of the ASIC3 current, on the other hand, is much less or completely insensitive to amiloride [28,45]. A recent study has shown that in cardiac sensory neurons, the small sustained ASIC3-like current activated at pH 7.0 is in fact increased by amiloride [46].…”

Is TRPV1 a useful target in respiratory diseases?

“…The airway C-fiber response to acid has both transient and sustained components. Electrophysiological and pharmacological studies show that the TRPV1-mediated response to acid is sustained, while most of the ASIC-type receptors mediate brief transient responses [45,67].…”