We have cloned and expressed a novel proton-gated Na ؉ channel subunit that is specific for sensory neurons. In COS cells, it forms a Na ؉ channel that responds to a drop of the extracellular pH with both a rapidly inactivating and a sustained Na ؉ current. This biphasic kinetic closely resembles that of the H ؉ -gated current described in sensory neurons of dorsal root ganglia (1). Both the abundance of this novel H؉ -gated Na ؉ channel subunit in sensory neurons and the kinetics of the channel suggest that it is part of the channel complex responsible for the sustained H ؉ -activated cation current in sensory neurons that is thought to be important for the prolonged perception of pain that accompanies tissue acidosis (1, 2).Many painful inflammatory and ischemic conditions are accompanied by a decrease of the extracellular pH (2, 3). H ϩ -gated cation channels are present in sensory neurons (1, 4 -6), and it is likely that those acid-sensing ion channels are the link between tissue acidosis and pain. We recently cloned a rapidly inactivating H ϩ -gated cation channel ASIC 1 (7) (acid-sensing ion channel). Fast inactivating H ϩ -gated cation currents were described in neurons of the central nervous system (6,8,9) and in sensory neurons (4 -6), tissues where ASIC is well expressed (7). However, rapidly inactivating H ϩ -gated cation channels cannot account solely for the prolonged sensation of pain that accompanies tissue acidosis. Sensory neurons respond to a drop in pH with a rapidly inactivating followed by a sustained current, which is thought to mediate the non-adaptive pain caused by acids (1). Here we describe the cloning of a H ϩ -gated cation channel specific for sensory neurons that has both a rapidly inactivating and a sustained component. MATERIALS AND METHODSCloning of DRASIC-We used an anchored PCR approach to identify the sequences upstream and downstream of the expressed sequence tag (W62694). An double stranded adapter (anchor) was prepared by annealing the oligonucleotides GATTTAGGTGACACTATAGAATCGA-GGTCGACGGTATCCAGTCGACGAATTC and PO 4 -GAATTCGTCGA-CTG-NH 2 . The shorter oligonucleotide was protected with a 3Ј NH 2 group to avoid extension during the PCR reaction. This adapter was ligated to double stranded rat brain cDNA resulting in a cDNA with known sequences (the anchor) on both extremities. The so prepared anchored cDNA was used to amplify the 5Ј and the 3Ј end of the coding sequence by PCR. This was done using either the primer GATTTAG-GTGACACTATAGAA or TAGAATCGAGGTCGACGGTATC, which are identical to parts of the longer of the two adapter oligonucleotides together with either the sense primer (CACTACACGCTATGCCAAGG, for amplification of the 3Ј end) or the antisense primer (CCCAG-CAACTCCGACACTTC, for amplification of the 5Ј end) complementary to the expressed sequence tag (W62694). The PCR products were subcloned into Bluescript, and five clones each for the 5Ј PCR and for the 3Ј PCR were sequenced. The anchored PCR allowed us to identify the sequences upstream of the first ATG codon and down...

Nonsteroid anti-inflammatory drugs (NSAIDs) are major drugs against inflammation and pain. They are well known inhibitors of cyclooxygenases (COXs). However, many studies indicate that they may also act on other targets. Acidosis is observed in inflammatory conditions such as chronic joint inflammation, in tumors and after ischemia, and greatly contributes to pain and hyperalgesia. Administration of NSAIDs reduces low-pH-induced pain. The acid sensitivity of nociceptors is associated with activation of H(+)-gated ion channels. Several of these, cloned recently, correspond to the acid-sensing ion channels (ASICs) and others to the vanilloid receptor family. This paper shows (1) that ASIC mRNAs are present in many small sensory neurons along with substance P and isolectin B4 and that, in case of inflammation, ASIC1a appears in some larger Abeta fibers, (2) that NSAIDs prevent the large increase of ASIC expression in sensory neurons induced by inflammation, and (3) that NSAIDs such as aspirin, diclofenac, and flurbiprofen directly inhibit ASIC currents on sensory neurons and when cloned ASICs are heterologously expressed. These results suggest that the combined capacity to block COXs and inhibit both inflammation-induced expression and activity of ASICs present in nociceptors is an important factor in the action of NSAIDs against pain.

No abstract