This comprehensive study is related to gold nanoparticles (GNPs) conjugated with antibodies. The goal of the study is to determine the minimal concentration of antibodies for conjugate synthesis when the conjugates have high antigen-capturing activity. Two systems were studied: gold nanoparticles conjugated with monoclonal antibodies (mAb-GNP) specific to Helicobacter pylori and gold nanoparticles conjugated with polyclonal antibodies (pAb-GNP) specific to mouse immunoglobulins. Several conjugates were synthesized with different GNP-to-antibody molar ratios (from 1:1 to 1:245) through nondirectional and noncovalent immobilization on a surface of GNPs with a diameter of 25.3 ± 4.6 nm. The maximal antigen-capturing activities and equilibrium constants of the conjugates correlate with the formation of a constant hydrodynamic radius of the conjugates for mAb-GNP (GNP to antibody molar ratio 1:58) and with the stabilizing concentration by flocculation curves for pAb-GNP (GNP to antibody molar ratio 1:116). The application of the conjugates to the lateral flow immunoassay shows that the antibody concentrations used for the conjugation can be reduced (below the stabilizing concentration) without losing activity for the mAb-GNP conjugates. The findings highlight that the optimal concentration of antibodies immobilized on the surface of GNPs is not always equal to the stabilizing concentration determined by the flocculation curve.

No abstract

No abstract

No abstract

The crystal structure of the aminopeptidase APDkam589 from the thermophilic crenarchaeon Desulfurococcus kamchatkensis was determined at a resolution of 3.0 Å . In the crystal, the monomer of APDkam589 and its symmetry-related monomers are densely packed to form a 12-subunit complex. Single-particle electron-microscopy analysis confirms that APDkam589 is present as a compact dodecamer in solution. The APDkam589 molecule is built similarly to the molecules of the PhTET peptidases, which have the highest sequence identity to APDkam589 among known structures and were isolated from the more thermostable archaeon Pyrococcus horikoshii. A comparison of the interactions of the subunits in APDkam589 with those in PhTET1, PhTET2 and PhTET3 reveals that APDkam589 has a much lower total number of salt bridges, which correlates with the lower thermostability of APDkam589. The monomer of APDkam589 has six Trp residues, five of which are on the external surface of the dodecamer. A superposition of the structure of APDkam589 with those having a high sequence similarity to APDkam589 reveals that, although the positions of Trp45, Trp252 and Trp358 are not conserved in the sequences, the spatial locations of the Trp residues in these models are similar.

Prolidases are peptidases that are specific for dipeptides with proline as the second residue. The structure of recombinant prolidase from the hyperthermophilic archaeonThermococcus sibiricus(Tsprol) was determined at 2.6 Å resolution. The homodimer ofTsprol is characterized by a complete lack of interactions between the N- and C-terminal domains of the two subunits and hence can be considered to be the most open structure when compared with previously structurally studied prolidases. This structure exists owing to intermolecular coordination bonds between cadmium ions derived from the crystallization solution and histidine residues of a His tag and aspartate and glutamate residues, which link the dimers to each other. This linking leads to the formation of a crystal with a loose packing of protein molecules and low resistance to mechanical influence and temperature increase.

30Hyperthermophilic microorganisms, which form closed, resistant to various physical and chemical environmental factors, communities of deep hot springs, are a unique object of study of mechanisms of adaptation and stress tolerance. Complete sequencing and annotation of their genomes allow to study extremozyme and the mechanisms of protein adapta tion at the molecular level.This work is devoted to purification and character ization of a new (hypothetical) aminopeptidase from the anaerobic crenarchaeon D. kamchatkensis, which complete genome has recently been sequenced and annotated [1,2]. The alignment of the amino acid sequence of the protein using the BLAST software [3] showed that the closest homologues of the protein are the hypothetical cellulases of D. mucosus and T. aggregans (87 and 76% homology, respectively) and metal dependent aminopeptidases of the M42 family [4] of S. marinus and T. uzoniensis (55 and 53% homology, respectively). The homology with the most studied enzymes of this class, multisubunit aminopep tidases PhTET1, PhTET2, and PhTET3 from P. hori koshii [5, 6] was 48%.To clone the Dkam_0589 gene and construct a pro ducer strain of recombinant APDkam589, containing the sequence of six histidine residues at the N termi nus, we applied the classic approach: PCR on the tem plate of the genomic DNA from D. kamchatkensis using oligonucleotides 5' GAGGGATCCGGTGAA CACCTTGGAATGGAGGG 3' (forward primer) and 5' GTAGGATCCACAACAGGCTCCTCAT AGCTT 3' (reverse primer). The primers were synthe sized on the basis of the nucleotide sequence of the gene, which was flanked by BamHI sites. The PCR product and pET 15b vector were then treated with the restriction endonuclease BamHI. The restriction fragments were isolated from agarose gel, ligated, and transfected into E. coli strain DH10B cells. After veri fying the cloning accuracy by automatic sequencing, the resulting plasmid construct pET_APDkam589 was transformed the Rosetta gami DE3 strain. The pro ducer strain was grown at 37°C in LB medium (RPI, United States) containing 100 µg/ml ampicillin and 20 µg/ml chloramphenicol. Expression was induced by addition of 1 mM IPTG followed by incubation at 37°C for 3 h. To isolate APDkam589, E. coli cells were disrupted by French press, heated at 70°C for 10 min, and the target protein was purified by metal chelate chromatography on Ni 2+ Sepharose FF and gel filtra tion on SuperdexTM 200 10/300. The molecular weight of the monomer of the recombinant APDkam589, determined by SDS PAGE, was 43.2 kDa, which was consistent with the calculated value. The yield of the protein was 5-6 mg from 1 L of culture medium at 95% purity.The APDkam589 activity was studied with cellu lose and peptide substrates ( Table 1). As shown in Table 1, APDkam589 did not exhibit endoglucanase, N deblocking, and endoproteolytic activities. The analysis of the products of enzymatic hydrolysis of low molecular weight peptides showed that APDkam589 catalyzes the cleavage of the N terminal nonpolar amino acid residue. Further cleavage of the dipepti...

DNA ligases join single-strand breaks in double-stranded DNA by catalyzing the formation of a phosphodiester bond between adjacent 5′-phosphate and 3′-hydroxyl termini. Their function is essential to maintain the integrity of the genome in DNA replication, recombination and repair. A recombinant ATP-dependent DNA ligase from the hyperthermophilic anaerobic archaeonThermococcus sibiricuswas expressed inEscherichia coliand purified. Crystals were grown by vapour diffusion using the hanging-drop method with 17%(w/v) PEG 4000 and 8.5%(v/v) 2-propanol as precipitants. A diffraction experiment was performed with a single crystal, which diffracted X-rays to 3.0 Å resolution. The crystal belonged to space groupP212121, with unit-cell parametersa = 58.590,b= 87.540,c= 126.300 Å.