Characterization of a novel M42 aminopeptidase from crenarchaeon Desulfurococcus kamchatkensis

Abstract

30Hyperthermophilic microorganisms, which form closed, resistant to various physical and chemical environmental factors, communities of deep hot springs, are a unique object of study of mechanisms of adaptation and stress tolerance. Complete sequencing and annotation of their genomes allow to study extremozyme and the mechanisms of protein adapta tion at the molecular level.This work is devoted to purification and character ization of a new (hypothetical) aminopeptidase from the anaerobic crenarchaeon D. kamchatkensis, which complete genome has recently been sequenced and annotated [1,2]. The alignment of the amino acid sequence of the protein using the BLAST software [3] showed that the closest homologues of the protein are the hypothetical cellulases of D. mucosus and T. aggregans (87 and 76% homology, respectively) and metal dependent aminopeptidases of the M42 family [4] of S. marinus and T. uzoniensis (55 and 53% homology, respectively). The homology with the most studied enzymes of this class, multisubunit aminopep tidases PhTET1, PhTET2, and PhTET3 from P. hori koshii [5, 6] was 48%.To clone the Dkam_0589 gene and construct a pro ducer strain of recombinant APDkam589, containing the sequence of six histidine residues at the N termi nus, we applied the classic approach: PCR on the tem plate of the genomic DNA from D. kamchatkensis using oligonucleotides 5' GAGGGATCCGGTGAA CACCTTGGAATGGAGGG 3' (forward primer) and 5' GTAGGATCCACAACAGGCTCCTCAT AGCTT 3' (reverse primer). The primers were synthe sized on the basis of the nucleotide sequence of the gene, which was flanked by BamHI sites. The PCR product and pET 15b vector were then treated with the restriction endonuclease BamHI. The restriction fragments were isolated from agarose gel, ligated, and transfected into E. coli strain DH10B cells. After veri fying the cloning accuracy by automatic sequencing, the resulting plasmid construct pET_APDkam589 was transformed the Rosetta gami DE3 strain. The pro ducer strain was grown at 37°C in LB medium (RPI, United States) containing 100 µg/ml ampicillin and 20 µg/ml chloramphenicol. Expression was induced by addition of 1 mM IPTG followed by incubation at 37°C for 3 h. To isolate APDkam589, E. coli cells were disrupted by French press, heated at 70°C for 10 min, and the target protein was purified by metal chelate chromatography on Ni 2+ Sepharose FF and gel filtra tion on SuperdexTM 200 10/300. The molecular weight of the monomer of the recombinant APDkam589, determined by SDS PAGE, was 43.2 kDa, which was consistent with the calculated value. The yield of the protein was 5-6 mg from 1 L of culture medium at 95% purity.The APDkam589 activity was studied with cellu lose and peptide substrates ( Table 1). As shown in Table 1, APDkam589 did not exhibit endoglucanase, N deblocking, and endoproteolytic activities. The analysis of the products of enzymatic hydrolysis of low molecular weight peptides showed that APDkam589 catalyzes the cleavage of the N terminal nonpolar amino acid residue. Further cleavage of the dipepti...

Structure of the dodecamer of the aminopeptidase APDkam598 from the archaeonDesulfurococcus kamchatkensis

“…the degradation of short peptides (6-12 residues in length) into free amino acids. It has been shown that APDkam598 catalyzes the degradation of tripeptides (Slutskaya et al, 2012) and cleaves uncharged amino-acid residues from the N-terminus. An investigation of the activity of the enzyme showed that it is maximal in combination with Mn 2+ , Mg 2+ and Zn 2+ (Slutskaya et al, 2012).…”

Heat-induced conformational changes of TET peptidase from crenarchaeon Desulfurococcus kamchatkensis

“…These local conformational changes probably reflect some "loosening" of the molecule, without significant bond breaking leading to irreversible thermal denaturation of the protein. It is not excluded that just these local conformational changes are responsible for the bell-shaped curve of the temperature dependence of the APDkam589 activity, which increases up to 70 °C but strongly decreases at higher temperature (Slutskaya et al 2012).…”

“…5-7) and by strong aggregation of the protein (Figs. 4b, 8), as well as by inhibition of its enzymatic activity (Slutskaya et al 2012).…”

“…Unlike PhTET peptidases, activation of APDkam589 is increased by Mn 2+ (Mg 2+ ). The temperature dependence of the activity of this enzyme is bell-shaped with a maximum at about 70 °C (Slutskaya et al 2012). However, it remained unclear which conformational changes at the secondary and tertiary structure levels contribute to the structural changes that occur in APDkam589 upon its thermal inactivation.…”

“…Recombinant APDkam589 was expressed in Escherichia coli and biochemically characterized (Slutskaya et al 2012). It was shown that APDkam589 is a large oligomeric complex, which cleaves strictly amino acids from the free N-terminus, with a preference for uncharged amino acids, and appears to lack N-terminal deblocking and endopeptidase activity.…”