In-depth site-specific investigations of protein glycosylation are the basis for understanding the biological function of glycoproteins. Mass spectrometry-based N- and O-glycopeptide analyses enable determination of the glycosylation site, site occupancy, as well as glycan varieties present on a particular site. However, the depth of information is highly dependent on the applied analytical tools, including glycopeptide fragmentation regimes and automated data analysis. Here, we used a small set of synthetic disialylated, biantennary N-glycopeptides to systematically tune Q-TOF instrument parameters towards optimal energy stepping collision induced dissociation (CID) of glycopeptides. A linear dependency of m/z-ratio and optimal fragmentation energy was found, showing that with increasing m/z-ratio, more energy is required for glycopeptide fragmentation. Based on these optimized fragmentation parameters, a method combining lower- and higher-energy CID was developed, allowing the online acquisition of glycan and peptide-specific fragments within a single tandem MS experiment. We validated this method analyzing a set of human immunoglobulins (IgA1+2, sIgA, IgG1+2, IgE, IgD, IgM) as well as bovine fetuin. These optimized fragmentation parameters also enabled software-assisted glycopeptide assignment of both N- and O-glycopeptides including information about the most abundant glycan compositions, peptide sequence and putative structures. Twenty-six out of 30 N-glycopeptides and four out of five O-glycopeptides carrying >110 different glycoforms could be identified by this optimized LC-ESI tandem MS method with minimal user input. The Q-TOF based glycopeptide analysis platform presented here opens the way to a range of different applications in glycoproteomics research as well as biopharmaceutical development and quality control.Graphical AbstractᅟElectronic supplementary materialThe online version of this article (doi:10.1007/s13361-015-1308-6) contains supplementary material, which is available to authorized users.

Mass spectrometry (MS) is used to quantify the relative distribution of glycans attached to particular protein glycosylation sites (micro-heterogeneity) and evaluate the molar site occupancy (macro-heterogeneity) in glycoproteomics. However, the accuracy of MS for such quantitative measurements remains to be clarified. As a key step towards this goal, a panel of related tryptic peptides with and without complex, biantennary, disialylated N-glycans was chemically synthesised by solid-phase peptide synthesis. Peptides mimicking those resulting from enzymatic deglycosylation using PNGase F/A and endo D/F/H were synthetically produced, carrying aspartic acid and N-acetylglucosamine-linked asparagine residues, respectively, at the glycosylation site. The MS ionisation/detection strengths of these pure, well-defined and quantified compounds were investigated using various MS ionisation techniques and mass analysers (ESI-IT, ESI-Q-TOF, MALDI-TOF, ESI/MALDI-FT-ICR-MS). Depending on the ion source/mass analyser, glycopeptides carrying complex-type N-glycans exhibited clearly lower signal strengths (10-50% of an unglycosylated peptide) when equimolar amounts were analysed. Less ionisation/detection bias was observed when the glycopeptides were analysed by nano-ESI and medium-pressure MALDI. The position of the glycosylation site within the tryptic peptides also influenced the signal response, in particular if detected as singly or doubly charged signals. This is the first study to systematically and quantitatively address and determine MS glycopeptide ionisation/detection strengths to evaluate glycoprotein micro-heterogeneity and macro-heterogeneity by label-free approaches. These data form a much needed knowledge base for accurate quantitative glycoproteomics.

Active RNase glycoprotein from three pieces: The glycoprotein enzyme ribonuclease C, which contains a complex saccharide N-glycan, was synthesized by sequential native chemical ligation. An optimized ligation and isolation protocol allowed the efficient assembly and refolding of the 124 amino acid enzyme.

Our results show that COPII coat recruitment by cargo receptors is not constitutive but instead is actively regulated by binding of mature ligands. Therefore, we reveal a novel functional link between luminal cargo maturation and COPII vesicle budding, providing a mechanism to adjust specialized COPII vesicle production to the amount and quality of their luminal cargos that are ready for ER exit. This helps to understand how the ER export machinery adapts to different needs for luminal cargo secretion.

The canine heartworm (Dirofilaria immitis) is a mosquito-borne parasitic nematode whose range is extending due to climate change. In a four-dimensional analysis involving HPLC, MALDI-TOF–MS and MS/MS in combination with chemical and enzymatic digestions, we here reveal an N-glycome of unprecedented complexity. We detect N-glycans of up to 7000 Da, which contain long fucosylated HexNAc-based repeats, as well as glucuronylated structures. While some modifications including LacdiNAc, chitobiose, α1,3-fucose and phosphorylcholine are familiar, anionic N-glycans have previously not been reported in nematodes. Glycan array data show that the neutral glycans are preferentially recognised by IgM in dog sera or by mannose binding lectin when antennal fucose and phosphorylcholine residues are removed; this pattern of reactivity is reversed for mammalian C-reactive protein, which can in turn be bound by the complement component C1q. Thereby, the N-glycans of D. immitis contain features which may either mediate immunomodulation of the host or confer the ability to avoid immune surveillance.

No abstract

Receptor Expression and Purification General remarks Codon-optimized genes for the expression of Langerin in E. coli were purchased from GenScript. All growth media or chemicals used for receptor expression and purification were purchased from Carl Roth if not stated otherwise. Langerin ECD The truncated Langerin ECD (residues 148 to 328, forward primer: GGTGGTCATATGGCCTCGAC GCTGAATGCCCAGATTCCGG, reverse primer: ACCACCAAGCTTTTATTTTTCAAACTGCGG ATG) was cloned with a C-terminal TEV cleavage site and a Strep-tag II into a pET30a expression vector (EMD Millipore) and expressed insolubly in E. coli BL21 * (DE3) (Invitrogen). Precultures were incubated overnight in LB medium supplemented with 35 µg•ml-1 Kanamycin (50 ml) at 37° C and 220 rpm. The preculture was diluted to an OD 600 of 0.1 into LB medium supplemented with 35 mg•ml-1 Kanamycin (500 ml). The culture was incubated at 37° C and 220 rpm and expression of the Langerin ECD was induced with 0.5 mM IPTG at an OD 600 of 0.6 to 0.8. Cells were harvested 4 h after induction via centrifugation at 4000 g and 4° C for 20 min. Cell pellets were stored overnight at-20° C and subsequently resuspended in 50 mM Tris with 0.1% Triton X-100 and 10 mM MgCl 2 (20 ml) at pH 7.5. Lysozyme (Sigma Aldrich) was added and the sample was incubated for 3.5 h at 4° C. After the addition of DNase I (AppliChem) the sample was incubated for another 30 min at 4° C.

No abstract