¹⁹F NMR-Guided Design of Glycomimetic Langerin Ligands

Abstract

Receptor Expression and Purification General remarks Codon-optimized genes for the expression of Langerin in E. coli were purchased from GenScript. All growth media or chemicals used for receptor expression and purification were purchased from Carl Roth if not stated otherwise. Langerin ECD The truncated Langerin ECD (residues 148 to 328, forward primer: GGTGGTCATATGGCCTCGAC GCTGAATGCCCAGATTCCGG, reverse primer: ACCACCAAGCTTTTATTTTTCAAACTGCGG ATG) was cloned with a C-terminal TEV cleavage site and a Strep-tag II into a pET30a expression vector (EMD Millipore) and expressed insolubly in E. coli BL21 * (DE3) (Invitrogen). Precultures were incubated overnight in LB medium supplemented with 35 µg•ml-1 Kanamycin (50 ml) at 37° C and 220 rpm. The preculture was diluted to an OD 600 of 0.1 into LB medium supplemented with 35 mg•ml-1 Kanamycin (500 ml). The culture was incubated at 37° C and 220 rpm and expression of the Langerin ECD was induced with 0.5 mM IPTG at an OD 600 of 0.6 to 0.8. Cells were harvested 4 h after induction via centrifugation at 4000 g and 4° C for 20 min. Cell pellets were stored overnight at-20° C and subsequently resuspended in 50 mM Tris with 0.1% Triton X-100 and 10 mM MgCl 2 (20 ml) at pH 7.5. Lysozyme (Sigma Aldrich) was added and the sample was incubated for 3.5 h at 4° C. After the addition of DNase I (AppliChem) the sample was incubated for another 30 min at 4° C.

Calcium‐Independent Activation of an Allosteric Network in Langerin by Heparin Oligosaccharides

“…Here, we identified three hexameric heparins (with different sulfation patterns) that interact with human Langerin by screening a focused glycosaminoglycan array . Binding to the Langerin CRD in its apo (Ca 2+ ‐free) state was discovered by using 1 H, 15 N HSQC NMR and by a recently developed 19 F NMR reporter displacement assay . Heparin recognition affected residues of the allosteric network; this was not observed for a selection of corresponding monosaccharides.…”

“…Not only did all three heparin hexasaccharides interact with apo Langerin inducing significant CSPs, these arose predominately from residues previously identified as part of the intradomain allosteric network. Notably, the stronger CSPs observed in the apo state indicate that the oligomers preferentially interact with the canonical site in the holo form; this interaction results in limited CSP, as for other classes of glycans . In order to assess interactions of the oligomeric heparins with the primary canonical binding site in the presence of Ca 2+ , we applied a recently developed 19 F NMR reporter displacement assay (Figure ), where binding to the primary interaction site involves competition with the fluorinated N ‐acetyl mannosamine analogue 4 .…”

“…Notably, the stronger CSPs observed in the apo state indicate that the oligomers preferentially interact with the canonical site in the holo form; this interaction results in limited CSP, as for other classes of glycans . In order to assess interactions of the oligomeric heparins with the primary canonical binding site in the presence of Ca 2+ , we applied a recently developed 19 F NMR reporter displacement assay (Figure ), where binding to the primary interaction site involves competition with the fluorinated N ‐acetyl mannosamine analogue 4 . This competition is quantified by following changes in the transverse relaxation rate ( R 2,obs ) of the reporter's trifluoromethyl group.…”

A specific, glycomimetic Langerin ligand for human Langerhans cell targeting

“…Prompted by the 10-fold affinity increase (KD = 0.49±0.05 mM) over mannose (Man) disaccharides (KD = ca. 4 mM) recently reported for a heparin-derived trisaccharide, we employed ligand-observed 19 F R2-filtered NMR experiments to determine KI values for a set of differentially sulfated GlcNAc derivatives ( Figure 1a) 37,39,50 . Interestingly, the affinities of glucosamine-2-sulfate (GlcNS) (KI = 1.4±0.2 mM), N-acetyl glucosamine-6-sulfate (GlcNAc-6-OS) (KI = 0.6±0.1 mM) and glucosamine-2-sulfate-6-sulfate (GlcNS-6-OS) (KI = 0.28±0.06 mM) were comparable or higher than those observed for heparin-derived oligosaccharides and other monosaccharides including Glc (KI = 21±4 mM), GlcNAc (KI = 4.1±0.7 mM) and Man (KI = 4.5±0.5 mM) ( Supplementary Figure 1, Supplementary Table 1) 48 .…”

“…All growth media or chemicals used for receptor expression and purification were purchased from Carl Roth if not stated otherwise.Langerin extracellular domain. Expression and purification were conducted as previously published50 .Briefly, the trimeric Langerin extracellular domain (ECD) was expressed insolubly in E. coli BL21* (DE3) (Invitrogen). Following enzymatic cell lysis, inclusion bodies were harvested and subsequently solubilized.…”