The proteasome regulates cellular processes as diverse as cell cycle progression and NF-B activation. In this study, we show that the potent antitumor natural product epoxomicin specifically targets the proteasome. Utilizing biotinylated-epoxomicin as a molecular probe, we demonstrate that epoxomicin covalently binds to the LMP7, X, MECL1, and Z catalytic subunits of the proteasome. Enzymatic analyses with purified bovine erythrocyte proteasome reveal that epoxomicin potently inhibits primarily the chymotrypsin-like activity. The trypsin-like and peptidyl-glutamyl peptide hydrolyzing catalytic activities also are inhibited at 100-and 1,000-fold slower rates, respectively. In contrast to peptide aldehyde proteasome inhibitors, epoxomicin does not inhibit nonproteasomal proteases such trypsin, chymotrypsin, papain, calpain, and cathepsin B at concentrations of up to 50 M. In addition, epoxomicin is a more potent inhibitor of the chymotrypsin-like activity than lactacystin and the peptide vinyl sulfone NLVS. Epoxomicin also effectively inhibits NF-B activation in vitro and potently blocks in vivo inf lammation in the murine ear edema assay. These results thus define epoxomicin as a novel proteasome inhibitor that likely will prove useful in exploring the role of the proteasome in various in vivo and in vitro systems.

During cell division, mitotic spindles are assembled by microtubule-based motor proteins. The bipolar organization of spindles is essential for proper segregation of chromosomes, and requires plus-end-directed homotetrameric motor proteins of the widely conserved kinesin-5 (BimC) family. Hypotheses for bipolar spindle formation include the 'push-pull mitotic muscle' model, in which kinesin-5 and opposing motor proteins act between overlapping microtubules. However, the precise roles of kinesin-5 during this process are unknown. Here we show that the vertebrate kinesin-5 Eg5 drives the sliding of microtubules depending on their relative orientation. We found in controlled in vitro assays that Eg5 has the remarkable capability of simultaneously moving at approximately 20 nm s(-1) towards the plus-ends of each of the two microtubules it crosslinks. For anti-parallel microtubules, this results in relative sliding at approximately 40 nm s(-1), comparable to spindle pole separation rates in vivo. Furthermore, we found that Eg5 can tether microtubule plus-ends, suggesting an additional microtubule-binding mode for Eg5. Our results demonstrate how members of the kinesin-5 family are likely to function in mitosis, pushing apart interpolar microtubules as well as recruiting microtubules into bundles that are subsequently polarized by relative sliding.

In recent years, the multi-subunit IKK complex has been shown to be responsible for cytokine-mediated stimulation of genes involved in inflammation and as such represents an attractive target for pharmaceutical intervention. Our finding that parthenolide targets this kinase complex provides a possible molecular basis for the anti-inflammatory properties of parthenolide. In addition, these results may be useful in the development of additional anti-inflammatory agents.

NOMPB, the Drosophila homolog of IFT88, is required for the assembly of sensory cilia but not for the extension or function of the sperm flagellum. Assembly of this extremely long axoneme is therefore independent of IFT.

Although assembly of the mitotic spindle is known to be a precisely controlled process, regulation of the key motor proteins involved remains poorly understood. In eukaryotes, homotetrameric kinesin-5 motors are required for bipolar spindle formation. Eg5, the vertebrate kinesin-5, has two modes of motion: an adenosine triphosphate (ATP)–dependent directional mode and a diffusive mode that does not require ATP hydrolysis. We use single-molecule experiments to examine how the switching between these modes is controlled. We find that Eg5 diffuses along individual microtubules without detectable directional bias at close to physiological ionic strength. Eg5's motility becomes directional when bound between two microtubules. Such activation through binding cargo, which, for Eg5, is a second microtubule, is analogous to known mechanisms for other kinesins. In the spindle, this might allow Eg5 to diffuse on single microtubules without hydrolyzing ATP until the motor is activated by binding to another microtubule. This mechanism would increase energy and filament cross-linking efficiency.

SUMMARYMutations that disrupt function of the human inwardly rectifying potassium channel KIR2.1 are associated with the craniofacial and digital defects of Andersen-Tawil Syndrome, but the contribution of Kir channels to development is undefined. Deletion of mouse Kir2.1 also causes cleft palate and digital defects. These defects are strikingly similar to phenotypes that result from disrupted TGF/BMP signaling. We use Drosophila melanogaster to show that a Kir2.1 homolog, Irk2, affects development by disrupting BMP signaling. Phenotypes of irk2 deficient lines, a mutant irk2 allele, irk2 siRNA and expression of a dominant-negative Irk2 subunit (Irk2DN) all demonstrate that Irk2 function is necessary for development of the adult wing. Compromised Irk2 function causes wingpatterning defects similar to those found when signaling through a Drosophila BMP homolog, Decapentaplegic (Dpp), is disrupted. To determine whether Irk2 plays a role in the Dpp pathway, we generated flies in which both Irk2 and Dpp functions are reduced. Irk2DN phenotypes are enhanced by decreased Dpp signaling. In wild-type flies, Dpp signaling can be detected in stripes along the anterior/posterior boundary of the larval imaginal wing disc. Reducing function of Irk2 with siRNA, an irk2 deletion, or expression of Irk2DN reduces the Dpp signal in the wing disc. As Irk channels contribute to Dpp signaling in flies, a similar role for Kir2.1 in BMP signaling may explain the morphological defects of Andersen-Tawil Syndrome and the Kir2.1 knockout mouse. DEVELOPMENT MATERIALS AND METHODS Maintenance of Drosophila stocksStocks were maintained on cornmeal food at 25°C or 18°C in a Percival incubator model 122 vL (Percival Scientific). Generation of the UAS-Irk2DN and UAS-Irk2WT fly strainsirk2A from Berlin w1118 fly cDNA was cloned into the EcoRI and XhoI sites of the pUAST vector. PCR was performed with cDNA template and primers (GGAATTCCATGCGTTTCAATTTCTCC and CCGCTCGAGCGGCTA -GGA GGCCTGGTCAGA) to add EcoRI and XhoI sites. Sequencing ensured fidelity of the construct. UAS-Irk2 DN was constructed by cutting irk2A out of UAS-irk2 WT with EcoRI and XhoI, and ligating into pET. The GYG of pET-Irk2A template plasmid was mutated to AAA using a QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) with the following primers: ACGCAGCACACTATTGCCGCTGCCGTCC-GAACCACCTCG and CGAGGTGGTTCGGACGGCAGCGGCAATA -GTGTGCTGCGT. Irk2-DN was removed from the pET vector with EcoRI and XhoI restriction enzymes and ligated into pUAST. All constructs were sequenced to verify the GYG to AAA mutations. We injected UAS-Irk2 WT or UAS-Irk2 DN plasmid with transposase DNA into 1-hour-old Berlin w1118 embryos. Matured injected flies were crossed to Berlin w1118 and progeny with the transgene were selected by eye color. irk1-AAA and irk3-AAA were generated with the same strategy using primer pairs: ACCCAGACGAC-GATAGCCGCTGCCAATC/CGTCACATAGCGATTGGCAGCGGCTA T -C (Irk1-AAA) and ATCGAGTCCAAGATACGAGTCTACATCATC/GAT-GATGTAGACTCGTATCTTGGACTCGATGGA (Irk3-AAA). Drosophila strainsT...

Small-molecule inhibitors of kinesin-5 (refs. 1-3), a protein essential for eukaryotic cell division, represent alternatives to antimitotic agents that target tubulin. While tubulin is needed for multiple intracellular processes, the known functions of kinesin-5 are limited to dividing cells, making it likely that kinesin-5 inhibitors would have fewer side effects than do tubulin-targeting drugs. Kinesin-5 inhibitors, such as monastrol, act through poorly understood allosteric mechanisms, not competing with ATP binding. Moreover, the microscopic mechanism of full-length kinesin-5 motility is not known. Here we characterize the motile properties and allosteric inhibition of Eg5, a vertebrate kinesin-5, using a GFP fusion protein in single-molecule fluorescence assays. We find that Eg5 is a processive kinesin whose motility includes, in addition to ATP-dependent directional motion, a diffusive component not requiring ATP hydrolysis. Monastrol suppresses the directional processive motility of microtubule-bound Eg5. These data on Eg5's allosteric inhibition will impact these inhibitors' use as probes and development as chemotherapeutic agents.

No abstract